Description :
From Genome Similarity Track
Location :
Scaffold_29:3227- 4674
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_29-fgenesh-gene-0.13Conserved gene of unknown function
Pytve_DAOMBR484maker-pve_contig_29-fgenesh-gene-0.1Anaphase-promoting complex subunit

Sequence
1447 bases(100 bases per row)
TCTGTCGGACTCACGTGTGAACGACGGCGCGGTCACCTTGAGCCACACGCCTTGGCCAGCCAAATGTGTAGTAGCCGCAAGAGAGAGGAGAAGCTCCGCC
GAAGAGCCACGCACGCCAACCAAACCAACACAGGGACGGTTCGTTCTTCCCCCTATGTCCAACGCCGCTGGGACAGCCATCAATCCTTGTTATCTCGCCA
CGAAAGCAGGCCATCCGCCCGCCTTCTCAGTTGCTGGCCGTTCGAATGGCTGCCTCCGCCTCACACGGCTCCGAACCACCGCACTGAAAAAAAAGAAAAC
TCTCTCTGTCTGGCTTCACTCGCCGCCGTCTCGATGTTCGCCGGGCGATCGTTCACCATCGCCTCACGAGGACGTTCACTTGCTGTCGGCGGGTTCAGCA
GCTGACGAGGCCGCCTGGTCGTTCTTCGGCTTGTCCGCCCAATAGTCGTCCATCTGGCGGTCCAACTGCGCCATCTTCGGGTCCGGGCCCTTCCCACCCT
CGTGCCAGTACGAGTCCATGTCCATGTCCAGGTCGTCGGACGTCACGTCCTTCTTCTTGAACTCGCCACGGCCACCGCGACCTCCTCCACGACCGCCGCG
ACCGCCTCGACCGCCACGGAAGCCCCGTCCGCCACGTCCACCACGCCCAGCGTTCACCACAACCTTCGGCGCGGCGCGGGCGGGCTTTGCGGACTGCTCG
AGGCCCTGACGCCGGTTCTGCACGACCTGCTGGCGCTTCGACCGGTTCGCAGCAGCAACCTGCTTGAGCTTGGCCGCGTTCTTGGCCTTGACCGCCGCCG
TTTGCGAGCGCAGCACGGGGCCGGTTTCGTGGTTGTTGCTGTTATTCTTGTTGCTGTACTTGACGCGGTGCTGCTGCTGCGGCGCCGACGTTCCCACGGG
AGCCTCCTGCGCCAAGTGCGTGAACCGGCTCGACAGCGGGATCTCCGACACGCCGATGACGGCCTTGCCGCCCGGACCGCCGCCGCCCGCGGGCTTACGA
CCGGCCTGCACGCCCTGGTTCACCTTGCGCTGTCCCTTGATCGACACGCGCGGGCCTCCGCGGCCCGCACCGCCCTGCCGCCGGTGCATGCTTGACTTCT
TGCTCGGTGGGTGGAACTTGCTCACTTGGTCGTTTAGAAAATCCAAGGCAAACACGAGGGGGCGGCGTCCTGAACACAGACACCCCTCCAGCACTAACGT
TGCGTGAAAGTTGCTCTACGATTGAATCTCAACTCCTGGTTGGGTTTTTCAAAATGAATGCGAAAACAAGGTGGCATTGAGATGTCGGTTTGAGGCAAGG
AAAACTGCGCGGGGTGAAGCGGCAGGCGATGGCTTCAGCAGATGGCGCGCTCGAGGCCGCGCTGGCGGCCAAGGTCCGCAGCTACCTGGATGCGAGCGTC
TACGGGACGGCGCGCTTCCTCGCGGAGCGGGTCGTCGCGCATGTACG