Description :
From Genome Similarity Track
Location :
Scaffold_283:32261- 43911
Transcript NameFunction/comments
Phypl_g6428hypothetical protein
Phypl_g6429hypothetical protein PHYSODRAFT_323484
Phypl_g6430pyruvate dehydrogenase [lipoamide]
Phypl_g6431conserved hypothetical protein
Phypl_g6432hypothetical protein PHYSODRAFT_469105

Sequence
11650 bases(100 bases per row)
CCGCATCACTTAACCTTGCCAGCCTACCAAAAAGCAATTCCTACACTTCCTCCACGGGGCCTGAGTAGTCTGCGAACATGTCGCTCTTGCCTTGTGCGCG
CTCTTTTGCGTCGGCCTCTGCACGCCAGAAACACCGACAACGTTATTAAAAGCAATTCAGCACAAACCTTTCAATCCAGCGAAGAGCCTACCATTAGCTT
CTCTGCACTGCGAGGGCTGGAAGGAATAGTGTGGCGGGTTCGACGGAGTCTGTCGCGACGGTCGAtgcggcgtcggcgacggcggacGCACTGGCATCCG
CTCGAACTCTCCCTCCAGACCTTCAAATGGGTTCGCGTCCCCTCTCCCCAGCAAACCACCACCAAAAATGTCTGCAATAAACAACAGCAGTCAGGAAATA
CGTACACCAGCACTACTGGCAAACTGCTTCACTTGTACCTTCAAACGGACGCAGCATTTCCTGTCTTAGGAAGTCGAACGGACTCATTTGCGCCTCGAAA
TCGTCGCCCCTGTGCCCAACGCAACCAAAAGTGAGCCAACCGCCTCTCGGTCCTCAAATGTCACCTTGAAATGGATCAAATGCACGAACCATTGCTGGAA
AAATGTGCCAAATTCCTGTTCGCCTCTGCGTTGTCGCCAAATTATCACGGAATTTCTCAGTTTCAAGACACCAAATTGTCACTTCGTGATTGCCACTTAC
CCTTTACGCGGGTCCATCCTCTCCCTATTGAAGTAGTCTCCAGCCGCGGCCTCGCCCccgtgctcgtcctccgtgatCTCCTTGCGGTTCGAGATGAGCT
CCTTGCGCGCGTTGGGGCACTGGCGAAagatcttcttgacgatctcgCACTTGCTGTCGCCGTTGATAGACCTGCAGGACTGCGACAGCGCTGTCGAGTA
GAAGCAGCCCGGATTGGCCTCGCGGTCCTTCTGGatcagctcctgctcctcgtcgctcagcgtcgGCATTCTCACTTCCAAGTGGCAATTACCTAACTGG
GAGAGGACGTTCTGGAACAAAGTTGCGAAATAGTGTGCACCACACCGTTTTATCACTGACAAACTGCTAAACGGCATAGAGAATGCTACTTCAACGACGT
ACGCTCTCAAGGAGTGcatgtcgctgctgtggtaTTTCCAGCGTGGTTTGACGAGCTTTGTTGCTAGCGATGAGTGACAGCGAGCGGGTTCCCGCGCACC
TGGAGCTTATTTCTTGCTccagcgaggacgagcgcttccCCGCGACGAATCTGACGCGGCCAGATGGCACTCAGTATGGCAATGGCACGCAACGAGCTGT
CTGGGAATCGGAAAAGTTCTGCGAGTTCCCGCAAGAGCTGGTGCTCCGAGTGAATCGAGGGCTGCCGACTCGCATCGAGCAGGTGAATCTGCTGTCGCAT
CCTTTTAAGGTGGCGACACGCGTGGAGATTTTCACGTCGTCCGCTGCGAGTGACGGCATTCATGATGGCAAGACTGGGGTGAGATTCGAAAGACTCGGGT
TTGTATGTTTTCTCAGCAGTGAGAACATGCAGTTCGGCGCATGCGAGCTTCAGGAGGTGCAACTGCCCTGGCCAACCGCTAAAATCACTCTGCTACGTCT
GGTGTTGCATTCTTGCCATCAAACGCGAGCAAACCTCTTTAGCCAAGTTGGACTAGCGTCTGTAGTAGCATTGGGGCCTCAGAAGGGCGCAGACGTGCTA
TTGCCTCTGATACCGTCTCCCAGAGCGAGCCCAGCTAAAGGTTCCATGTCACCGCGTCGACGAGCGCATGGCATATACTACGACACAATTCATTCCGGAC
CAACCCAAGAAGTTGCGGTTAAATCGCCACGTGCAATGGATATATGGATTCCAGATTCGCGAGAGCACAAGACACCTGAGCAAATATACGCAGATATTCA
TATCGGCAAACAGCTCGCCCAATTTGCCGGCGATGATAACTTCGTACAACCGTGGGTTTCCATGGAGCAAGAAGCCAACACACTGATGGTTCTGCTAGAA
CGCAAGCCACAGATGGAAAAGAGCACAGAAAATGTTTTGGAAATCTGTGCTGACCTCGATAATCGCAGAAAATGGCAAGAAAAGGTGCTCTCCCAGCACA
TGAATTCGTCATCTAAACCTCAATCGCCCAGCAACGACAGAAACGTGCTTCTAGCACAGCGAGGACCGAAACCACTCAAACGATACCAAACCGGCCAATC
GCGGGAGAAGGAAACGTTGTTATGGCAGCTCGCAGAGTGCTCTCAGACTCTGGCAGAAAAAGGGGGCCGACAAAGTTGTCAACTTGCACTAACAGATGCC
GAAGCGCTGGAAATCCTGATCACGGCATTAGACGACGCCAACGTTCAAGTATTTGTCGCTGCTTGCGCATTTTTCAGGGCGTTGCTAATCTCTTTGCCAT
ACTTCCAAGATACCGTCGCCTCAAAAACGGATGTTAGTAAATCTGCCTGTGAATGACTCCTGGTCATCTCCATCTAACAAAACTTACGGCTGTATTTTAG
CTTGCAGAGATTGTGGATTGTCTTCTGGAGAAGCTTGACTCTCGTGAGGCACCCATTCgcaatgctgcagcatttgcCCTTTTAAAGGTAAAGTGACTAA
GCCATCTCCATCGACAATCTCAACAAATTACGATTGCTTTGTCAATATGTTCGTAGGTCGCTGGATCCACACGCACAAGAGGCACGTTCGTGACGCACCT
ACTACTAAAACATGTCGAAAGTAAACACTTTCAGCCGTCagatcagcagcttctggcgtTGTTGAAACTATTGGCAGCGCTGTTGTTGTCATTTCACTGT
TGTGCAAGTTTCGATATCGCTCCTCGGCGAATTCTtcgcttcttgttgctcaGTGATGCAGACCAGCACGAGAACACATTAGTTCGCGACGCGGCCAAAC
AACTCGTTCTTGCAATCTGCAATGATGTGGACGAGGAGTTTGTACGGAAAAATTACATCCAACAGCTTCCACCCGAGCATCAGCGGCGATATGACCTCCC
TCTGCGTCGAAAAGCGTGATAGAAGCTTCTAAACTACCGAAAAATCAAGCGTTTCCTGATAACTCGCTACTGAACTACGCAATTATCGGTATCTTTCCCG
GCTTTGCCTTTGGGCTTCTCTTTGCTTTTAGCCTTTGTCTCACGACTGGGTTTGTTCGTTCTCTTTAGATGTTTTACACTTTCCGGATGCGTGGGAATTT
GTTCCATGATGGCTGGAAttgaagaggaaggaggaTCATCCGCTGGTGGAGTTGTAGCTGGCTGTTGATTCGTAGCGGTAGAGGATCGATTGGCGATCGC
AATTTCTGGTATAGGTGTTAAACCTCTTGCGTCCTGGACCGGGATCTTTGGAATCTCACTCGGCACCATATTGACGGTGTTAGTGATCACACTAGTGCCA
AATTGACTATTTCTCGAAACTGTTGTAGATtttgaagctggcggagcttGTATGTGTTGCTCGGGGGACACCTTGTTTGATCGTTTCGGTGGATCGCTAC
GCCGCTCAATTGTACCTCGAAAAGTAGCAAAATTTGACGCAATTTCTTGGTGGCCTGCGGAGTGAGGCGACTCTAACTTCTTGTCACCAACATCGAACAC
GAATGGGGCCGATTTTTGTTCAATTTCCTCGTGGAAGGTCCCTTTTGGTGGTGTTCGGGCGACAACCTCTCCTTGAAAAGCAATGTTGCCTTTTTGGAAT
GACGCACGAGTCACGAGTAGTCCTTCGTCCTTGGAGGCGGCTTGACTCGCGCGTACAAACGAATGCCGATAAAGCGCGTGTGGACGAGGTTGGGATACAA
AGTATCGCTGGAGTTGTGCGGTAAATTCCGTCACCTGGGCATCCAGCAGTGGGTCTTGAATAAAGAAAGCAGTATGAGAGTAGCGATGAGAATGGTGGCT
CTTGGCGTGGCTCGAGACTTCCAGATGTCGGCGGACGGAGGTCAACCGGTTGGCGCGTTCATTGTTTTGGTAACTGCTCGAAGCAGATCGATCGATTTCT
GCTAAGCACTCCGAAGCAAGGCGTGTTACAATTGTATCTTCACGGTCCGCTGTCAGTTGGGCACTTTGTGTAGATTTGTTCGAAGGTAATAGACTGGTGC
TAAGTGTATGAATACTCGATTTCACGTTTGCAGGCACCTGGCAGCGAATGATATCGTTGCGAACCACGAGACGAAGCAACCGCAAACGATTTCTTGCAAA
TGTGAGGCCTGCCGTGTTGCCGGTAGGAGTTAaatcaagaagctcatcgaAGAACTGTGTGCAAGTTAAATCCTGTTCGACCAGCAAGCGGACAAACTGC
AAAAAATCTCTATCGATGGATGGTGGAGCTGAAGAAAATCGGCTCAAACCGTTGGGGATCGTCTTAGATGGCATTGTCGATTTACCAGTGTGGTTGATTA
ACCAGCAAAATGGACTTACAAGAGTCCACTCCAGAATGACTCGTAGGCCGTAACTCCAGTTGGCACACGTAACTTCGTCAATTAGTCCAAATGCTGAGGC
ACTTGTACAGTCCGGAAATATGCCACGTTCAGATTCCACGAGCTCTGACGCTTTCTTCACGATTGTCATGTCAGTCAGGAATGCGGTGTGTGCTAAATGA
ATTGCTGCCTGGAACACTTGGGATGACTTTGCCTCTCGGATGCCAAGAACGGTAAGCGCGACAATACCCTCGAACGCACAGGTTGCGCCAATGGACTTTT
TCATGAGAGGAGCAGTACGCTCGGCCATGTGTAAGCAAGTCAGTTGAATGTCCGCTCCACCGCAGAGCAAACACTGTGTAAAGAACGTTCCAAAGGTGTA
CAGCGTGATCTCGTTGCTGTTAGCGGGGTCACTTGGTGAAATCGTGGGAGACTGCCACGAAGATACTTCGTCTGTGAGTTTGCATATCTTTGTGGCCAGG
ATTTCCTCGAGCGTAGATCTCTCGAGAGAGGTTTGCTCGACATACTGTCGCAGGATGGTGTCGAAAGGTGACGCTGGATCCCTGTCTTCGCTGCTATTTT
CCGGCGGTGCCAATGTGGCATTATCAGGAACCGCTGCACCTTCATAGTTTGATTCTGGTGTGACCTCTACAGTGTCATCAATTGCTTGAGATGGCAGCAA
CATTCCAGCTTCACTGTTTGGAAGGCTGGCAACCTGTGCTACAAGATCCATCGGCACTCCAGCATCGAGTAGAACCGCCTGCAactcgtcgttgtcgctg
gTGAGAGAAAGCAGCGTAGGCCGATGAATCACCCCAGAACGATGGTTCATTaactcctcgtcctcttggACAGGGTGCAGACTCTGAGTAGGAGCCGAAG
CTTCAGCAAACCCTAACAGTTCAATATCGTCTAGCACAACCTGTACCAGTGGCTGTCAGTACGCATTGTGGCTGAAGACGATATTAGACATAGTGCATTC
AGTACCTCTTGAGACTGATTCCGTAGGCTCGCATGCGGTGTGTGGACAACGAGTTTGACAAAAGAACACTCTGGTGCATCCAAGCGAATGGTCCTGGAAT
CGATATCTCGAGCTGTGTCTAACCTTGCTGACGAGCACTCCTCCCATACTAAAGGTTCGCTACAAAGCGCATGAACCACGAAGCTTTAGCATCAATGAAT
ACAATGAGATCTGGAAGAGCTTCCGACCCACCCACCAGCATTGCTTCCAGTCGACACTAAGATAACGAGATATAGAGTCAAGAGCGCTCAGCGCGTTAAT
AGATCCTTGTCGTGGCGGTAATGCAGCAAACACGACAACTAGGATGACAAACAGCGATTAGAGACGCAACGTGTGTACGATCCAAGTTGCTGTTACCGCC
AACTTACTTTTTGCAGGGGCCCGGGCAACCTCTACGGCCAGACGCAGAGCCTTGATCGTCGCAGGTTGAGCAGATAGTAGAATCAGCCCCAGCTCTTGTG
GGAACGGAGTGTTACTGTATCAAGAAATCGTTAGACGGGCATCGACACTCCTCGAgtgctcgacgctgcggcgcTTACGGTTTGGATTTCCAAAGTGGCT
GGTTCTCGGACTCCTCGACGGCACCAGGTGGCTGCCAACGGTGCCGATCACTTCGAGCAGCGACCTGCAGATCCAAGTCGTTCACAACAAGCAGTCGGAA
CGGAAGACTGTACATGGCATTACTGTAAGACCTCCACTCCATCAACCCGCGAGAAGGAAACGGCTCGTTCAGATTAGACGAGAGGAGTTTGGACTCGTCA
GCTCTTAGTGCTCACCAGCCCGTCCTTAGAAGATACCCCATCCATCGAATCATAGGTCCACACTGCATTTGTCTCCATCCTGCTGCAAGCATTCTGCTTA
AAATTCGGAAACAGTCTCGCCGACGAATTGACCTATTTTACTTGAGCTCCGAGGCGCCGGTGAGGCAGCTCATGTAAATATACGTGTCCACGCCGTGGCC
CTCCATGGGCATGATCGCCAACTCGCCACCGAAGTACTTGGCGTAGAGCTGCGCGATACGCAGACCGAACGAGTCCGAGAAGTCCAGTCCGCTGGCACGt
ctctccagcacctccgcGACGGGGTCGTATCCGCTCGAGGGCGGGGACGTGGCCGTGTGGTAGTAGTTCGACAGTGCGTTGGCTTCCTTGCGGGTCATAC
CGCCACCCAGGTCCGACACCTTGACGCACACGCCGTGGGGCCCCCCAGAGATCAACACGTTGACTGGCGGAGGCGTCGACGCCCCCGTcctcttggcggc
ggcgacgctgttCAGCACGGCGTTCTTGAACACCTCCGTCAAGATGATCTCAATGTGCTGCGGCACGTAGCGGTAAGTGGCGTCTTGATCGCCGCTGACA
ACGATCTCGggcagctgctcgccgtTGAGGCTCTCCTGCCACAACGGACGCACCTTCTGCACGATGCTCTGTGCGATCTTGACGGGCGACGTCTCGTCGT
TGACGATGCCTGTGAAGCCGGGCGTGGGGGTCTGCGccgcgacgtgctggtccACGAGCATGCGGATGCCGATGCGCGAGTTGTAGAAGTTgtccagcga
ctcgctgAGGCCCTGCGGCTCGTACTCGAGCGCCTGGACGGCCTCGGCGATGTTGCCGTGCATGGAGGCGTGCTCCGTGCGgatcttgcgctgcagcgcc
acgaagtcgcgctcgctcgcgAGGTTGGCGGGCAGCGGGCAgctcgtgagctgctcgaagctgtccagcagcttctcgcgcaagGACACGATGGGCGAGG
CccgcggcagctcgtccggcAGGTTCTCGAGGTCCACGATGCGGCGCGCGATGCGGATCGGCACctcgcggtgcagcagctgcgcggACGTGACGATGGC
GGGCGCGTTCGCCTCGCGCCACTTGGCTAACGCCTGCGGGTCGCTCTGCAGCgacgcggcgacggcggggCTCGCGCGCGGCccgcgcttcagcagcgcc
tgcagcgtgaTGGGCGGCAGCGGGATGTGGTGCAGGCGGTacacctcggccagcaccttggctCCTGcggacgtggccatggcTGAAAGAAACTTGGGGA
ATGAAGACGAGCGTAGGAGCTCCTGAGCTGCTCAAAAGTATATTCTTGTGGGATCGGCTCCGATTGCGCAATTTGGGTTTGCGACCAATGGGAGAAGCGT
GTTTCGCgtttcagccaatcacagTTTGCGTGTCAACGATCGGTTGAAGTGGGTCATTTATTTTCCCTGGACGACATGGAAGTTAGTTagacttgctgct
ggccgtcggCGTGGGGTACTAATAGGAAGGCTGCGTCGCCGTAGAACTGCGCCACGTAGTCCAGTTTGTCTTTTGCTGCTGGGTCGGCGCCTTTCTCCGC
GAGAAGAGCCGCGCACTTGGCGTTCCCGTGCAGCATCGCGCAGTGCAGAGGCGTCCAGCCGCAGCGATCCACTTGGCGCACGTCcgcgccagcggcgacg
agcgtgGATACGGCCGTGCTCATGCCTCGACTCGCTGCCCAGTGCAGGGCGGACCGGAGCTCTGCACTGgccaaggagacgctcgcACCGAGCGCCAGAA
GCCTCTGCACGACGTCGATGTGGCCGTTGGCCGCTGCGCACATGAGCGGGGTCCAgccgtggccgtcgcggGCGTTGATGTCCAGTCTTGGGCTTGTGCT
CTCGCCATTGGCGTCGTTCTGtggccgcggcgtcgtcatGTCAACGAGGAGATTGAGCACTTCGAGTTTACCGAAGTCGGCGGCGTAATGCAGCGCGGAC
CAGCCTGACGCGTCTCCGGCGTTCGGGTTGCAGCCCCGACTGATCCATTCTCGCACGAGCTCGGTATGGCCTCGACCACACGCCAGGCGCAGCTCTTGTC
CGTATTTGCATGCCGGAGCGTACACTAGCGCGAACACGTTTAGTAATTCTACTCGGGATACGAGGTCAGCTGACGGAGTAGCAGGCGtcccggcagcagc
ggaaggtgTGGCGTTGTCAACTGGGGGGCTTGCATTGCTTTCTGGAGCGGGGAGAGCGTCGCGTACTGGAAAGCATGGTACCACAAGCGACTTGTACAGC
TCGTCGGAGAGGGTCAAACCTGCTCGTCGTAGCAGATCTGGGACCCTGTCGATGGCGATGACGTCTCCAGCATTctctgctgcatctgcgtcgAGCACTT
TCGTGAGTACTTCGAAGTCCCGTTCCCGGAGCTCACTAATGCGCGCCACTTCCACTCTGCTGGGACCATCAACCACGCCGCCACTCGCCGACAGAGTGGT
CaaacgagctgcggcggtAGATGCGTCACTTGATGCAGCCAAGAACATCGTCTCCTTCTTTGGATTCTTCACGTTTGCAATTGTGAGGATCACGTTCGTC
CTCGTAGTAATACATGTGCCGTCACCGCCCAAGAAGATCTCCAGTGTGTGTTGATTGCAGTCCCACGAAGCTGTGAGAGCCTTGTTGTGATACACCGGCG
TTCGAAGCAGCGTCCGTGGTTGCCCCTCCATATCCCATCCGTCCGGCGGCAGCTCTATCAACAACTTCCCACCGGAAGGAACCTTGCCATTGACCGTAAA
CGCCAGCGTCACATCCGACACCGCCCCAGGACAGCAATTAAACGGGCTCCAACGCTTTGCGCCGCCAATTGACCCCGGGACAATCTTCGGTATAGTGAAC
GTCGCCGGCCCATCGATAATCTGGCCACCGCGGGTGGACGTCGGCACGATGGTCCTCGCCACCAGCCTCTCGAACGTCGTGACGATGGCTTCGCCCTGCG
GCGTCGCCTTCTCGGGAGTGCCAACCCccgacaccagcaccatcaagGGGGTATCAGCAGGTATCACACTCTCGTTCAGCAGGGTAAACTCCATCGTtcg
cgtcgaggagctccacgTCATCTTCACCtgtggcagcgctgcagtcgttGCGTGTTCGTTCGGAGATGGCAGTTGGAGCACCACATTCAGCGGCAAAGCA
GTCGGCACGGACCACCCGTGGTCCGGCAGTTGGCACGTGATCCTCGTGTGCTTGGCCAATGGGCCCGAGGTCTTGAAgcccagcgcgagcttgCCGACCA
CGCCGGGCGTGGCGAACTCGGGCTCCAGAGATTTGCGCCccttgaagctgccggcGACGATCTTGCGGTGCCGCTGCGCGAGTTGAAGGTGCGCACCccg
ctcctgctccgcaTCGTCGTGCATTGGCTGGGGCGAGGGAGAACCTCCCAGTCGCTTCATGATCGCCGGAGTCTCACGGAAGAAAATCTAGTCTGCGCCG
TCAAAACCGACCTCCCTATCATTAGGAGCAAACGCTGGCGTTTCGAGTGCATTTTCGGTGGGGTGAACGAGCAGAGGCGAGGAAGCCTTCAACCAGCGAC
ATGGCGTCGCCGAGATAGCGATGCTGCAAGCAGGTTATCCATCGCGCCGCAGCGAGCAAAGTGAAGCTCGGAGCGGTAGTGTGCCATACTCCAAGTTGGC
TCCCTGCGACACCATCGCTCCAAATGATCGCCGAGTGCGTAATCCCCGCGAAACGCGGTATTCTCTATCGCTAGCGTCGTAGACGGGGGATATGATACGA
AAGTTTATCTACCCATACGAAAGTCTGGTGCCAGTAGCAATGATTCTCGCACGAACCTCTGTCCGTATTAATTTATGAAGGTTTTTAGCGGCCGGTATAA
TTAGGCGCGATGCCCGGTTTGCGGCCGCACCAAGCGATTCTCACAACCAAACAGCAGGCGAGTCGCGCACGTTCAGCGCCGTTCCCTTACGCGGAAGAGG
AGGTCGAGCTCTTGGGGCGCCGCCACTCGATAACCAGACCGGCAGCAcgcagcgcgcagctccgaGGTACGTCGCGCGAGCGAAAGTCTCCGCCAAATAA
ACCGTGAAAACTCACCCCAATATACAGTTCGTTCAGCCAATCACCCGTCCGACTACCCTCGTAAGCCGTCGACAGTATgaggaggcgctggcagCTCCGC
GACAAGGAGAACTTCATCAACTATGTGAagatcgagctgcagctgctggccaaggagtGGAAAATCATCCTGCCGTGCGTCATCATGCAGTACGTCCACG
CCATCTTCCACAACCTGGCGTACTACATCCAGGGCAACTACCTGTCCACGGAGCAGCGCTTCACGCTCTACGACCTGGGCTACGAGCTCATGCCGGAGCT
GCACGGCTTCGCCGCGTCCATCTCGGACATCCTCGTGTTCGTCGCAGTCTTCGGCCCAGCCATCATCCTGGTGCTCACGATCCCCTTGTTCCGGCAGGAG
CCCGGCCGCCCGCGCTACCTCGTGatcgtgctcaagcgctgcctgctgcagctcagcatCTGCCTGGTCTTCCGCTGCATCTCGTTCCtcgtgacggcgc
tgccgtccCCCGCCGCGCACTGTGAGCTGAACTTTGACGCAACGTGCTTGGCGACGAACCCGGACGACCCGGTGCCGTGCGTCATTCCCAACCCAGACTT
CAACCCGCCCACCGTCAGCGAGTGGTTCACGCGCCTGGACTCGCTCAACGGCTGCGGTGACTTGATGTTCAGCTCGCACACAATCTATACGGTGTCGCTC
ATCCTCACGGTCTGGAAATTCTGGCCCAACAAGTACGGAATCACCATCATGGTCTGCGTGCAGATCACCATCGCCTTCCTGATTGTGGCCTCACGCAAGC
ACTACACGATCGACGTGTTCTCGGCGCTGTACGTCGTGCCGCTGTTCTGGCTCACGCTGGAGGCGTACCACAAGGACATCAACAACAAGGACTCGGAGGT
TACGGTCAAGAGCATCTACGACTTCTACGGAGTTGACGTGTCCAGCGATGCCAACGACGGCGCTGTGCCGCTCAACTCCAACGATGCTGTCCCGGCAACG
GCTCCGTTGAACTCGGTGCAGGTAGCAATGACGGAGGACGAGAGTCTCAGTGGCGAGCGATCGGACCCTGACAACGCGGCCACCAGTTTCCAGCGCAAGA
ATTCCCTGTAAGGTAGATGGAATACTTCATATGCACATCAAACAAATGGCTGCCGGGTTTGGCGGCCTGAGTACGCAGTTTTTTTCGCAAGCTGGTTCGT
TGATTTGCAAGGTTTCTGCCCTCCATCCTTGTGATTGATAGACGCATTACCCCCACGACTCCAGTGTTGTTTCTTGATCGAAATGCGACTGCTGTGCGCT
GATCTGAGAGAGCGTGTCCATGTCGGACAGATCGTCCGTACAGATGCTGG