Description :
From Genome Similarity Track
Location :
Scaffold_313:32256- 35346
Transcript NameFunction/comments
Phyci_256893Hypothetical protein
Phyci_74349Hypothetical protein
Phyci_162676Hypothetical protein

Sequence
3090 bases(100 bases per row)
cgaggagtaatgagacagggatcaactggagtgcgttggtcacgctagcggtgtgttggaagaaggatctgcagggtggctgcagattaatgggatgggt
aatgtatattgaagatctgacgatatgtgcgtcagatattggcaaacggaagactggcatggtgataattcctgcctaagggccccgatcactcgagaca
tgtcagaacagagacgccgaagatcaggtggatctgggtcaaacggatctgggatgagtggatccggaacgagctgatctaggtctttcgctgccggtac
tacgtggatccgacgtaaggagggactgatcacgtggctccggatctgaagtggaaatggatcGGGTGGATACGGATCCGAAGCGAAATGGAATATGTTT
GAATGAGGTGGATacgattggacagtggatctggacaggatctggggcaactcggaaggatccggcccctactcagcgtcaccagtgtggacaccgaaga
acttgtcggtgaggcacgcgatctggcgcgctgggtgatcttgaggactgtcgtggtagtggttgcgccacgaTTCAGCACCGTTGCACTCGTCCAAAGC
CACGAGCAGATCTGTGGACTCGGATCGGTTGAGACGACGGTTCGCGATATTGGCCTGACCAGATTCGTATCCCAGACACCAGATCACGGACTCTTGGCGA
GGGGAAAAATGTAGGAAGAAGAAATCCAACAGGATGTCCAGATCACACCACCCCTCCTGCGTTGCCACTATCAAGACTTGCAGAAACCCTTTCCAGCGGT
TCCCGGCGTGCGATCTGTGGTTGTTGCGCTCCTTGTGGTACTCTGCCAGCCAGGGATAAGCTTTCGCCGATGCCGGTAAGATCGGGAAGGAGTGCGGGAT
TCCCAATAGGCTTGACGAATTGCCTTCTCATAATTCTGGTGTTGCCGTATCGGGAGTCCAAGCCGGCCGCCAATGTCGGTCTCGAACGAGATCGCGCCAT
CTGAGTTCTCGAGAACCTCCCAGGGTCGCTTGGACAGCAGAGCTCGCACGTTGCCCTCAGTGCTCCCAGAAGACGTCGGTGTCGGCGACTTGAGGCCGAT
CGTTCGCCAACTCGAAATACGGGAAGATCTAGCCCGGATGTATCGGCAGGACAGGGAACAGTGCCTGGATCCGCATCGCGGCGAGGGTCTTGTTGTCGAG
ACCATCTGAGATCCAGGGATCTACGTCCGCCTGGATCAGGATCCGAGGTTGCCCTCGTCCAGGAACACATTGCGCCTCAGGTCCGAATGGAGCGACGGGC
GCCAGTGGATTACGAAAGGGACAACCCCGATTAGCCGGAACTGGGTTTGGCCCACGCGAACCCGGATCCGGGTTAACACCAGAGCCTTCGTCATCGACGG
GATCATCGTCCGGGGGTCCACCGGATACACTGATCACAGGTCCATGGCGGGGAGAGGCATGTTGACGACGGCGCTCGGCAGATCGAGACTGAGCCACGGC
CAGCAATGTCTGGGCTTCGAGTAGCTCGTTGGTGATCTGGGCCGATTCTTCACCCTCCGCTtcgtcatcgttggtaccaccagtaccgctggtatcctcg
ccttcctcctcttcctcctcgtcgtcagcatcttcggcctccttgtcgccgtgatcttctccgggttcgtcctcgccgtcatctacgaaaccaccgtcat
cgtcgATCTGGCCTTCTTCAGCCAGATCATCCTGATCCAGGTGGTGTGCTGGTTCCGATCCCGCACCAACTTTAGACATCTCGACGTCGGAACGCTTGGT
CCCCTTATTTGGCACGGATCGGGAGAGACGCTCGCTTGGACGTGCTGGATCGCAACCCCTCGAGGCCGAGTCATGGCGAGCATGTTTTGAGGGCTCCGGG
TCCACGATCTCGCCGCTTCTCTTAGGACGCGTCTCTTATTGATCTGGACTATTGACCGCTTCGGCGGGCGAATGTTCTGAGGCAGGTTGATCTGGGACCT
CGCCACCGCTCTGGTGGTCCCCTTGAGGCTGAGGCAGCTCGcgaagtatacggagcaaagacgccggatatctcacctcgtcggtggggagaggccgtgc
acccacagcagtaaccacgaccaccagacgttggagaacgacgtcgtgttgcggagagtgttgcgattctgctgtagaatgttatgatcctgctggaggc
attcatgctgctctcggatctgctggatctgactctcgagcaaacccacggcccgctccgcagtgtccaagctcacccctgtgcggccgatttgcgtcag
gtcacggctaagaaatttcaagccaagacggagaaacgtacggagatcctcaagctcagattgcgcacgatccgcgtccagtatagcgttatcccgctcc
tccacggtacttaccagatccgcagtggctgcagcatgggtgagtcgggcggtgctgagatcggcctgtgtctgccggagaagccctcgaatgtcatgca
gctcgtcgcgggtgatcccaaagcgacgatcagtctcggcgaacgcagcttgagcccgatcccactcttggatgaggcgatctcgctccgacgatgcaag
attacttccgtcgatttcgagcgctgcgggggaaatgtattgatggcgtcgcgcatgattcgctcctgcgctcgtggtgtgccatgatcatccgatggaa
tcggatgcttcgggagggcgacaactccgtggcttggctcgtgggtcgcgaggaagtggctggtgaacattcgctgcgggagcttcgtacgcaggtgtgt
accaacgcgtggaatgaggatcgggtctgttacgtacaagtctgcgagggttgtgccgtctgcggcagcttggagcattactccgaggcgaactggaccc
gcgaggtggccgagcggccgctcgatgaagcggatcagtcctggatcgccaagtatcggcgcgcgctcaattaggtctcggtggcttctattcgtggccc
aggccgtcgcgctcgttctcggcgaggtgcatccccgtcggcTCATGGTCGTTCGAGACCTCGGTCGCCGCAGGGTCGGCGTCGATGGAG