Description :
From Genome Similarity Track
Location :
Scaffold_38:32245- 34001
Transcript NameFunction/comments
Phyke_g4850hypothetical protein PHYSODRAFT_521876

Sequence
1756 bases(100 bases per row)
AGTCCTGTACCATGGGATTTCCTTATATAACCGCTGCAATATCTGCTTTGTCGACAACTTAAAAATACGCATACACACAATAAAAAAATCATCAATAATT
GGGCTTTGCAATCCAATATTGTCTTCACAATAATCCACACCTGTTCGAGTCCAGAATCCTCACGTTCCTCTGTAGCTTTTAGCCCTAGGGTTTCTTCAGG
TTTAGAGACTGTTCCAAATCCTAAttcaagctccagcagcgtctccaagTCCCCTGACCGGCTGTTTGTCTCGTGGATTTTTGGATTATTGGCCGCGTCT
GGGGGTggcgccttctccttggcgagATGTAAAGGCGGCAGTTCACACACCAGCCATTCCGCCACTCGTGTTGTATCCTTCGGGTGTCCCACGAGAcagc
gcgctgctgacgGTTCGCACGAAGCGTAGGAGAAGTCCCAGCCCAGAGACTCCCGCACCACGTGACGTACGTCCCGAGACATCGTCGCCCAATTGCAGAA
TAAATATTACAGGTTTGTCGATTAAATGTAGAAACGCTtggattggtggaaatgaTTTATTTGTAGATTGGAACGTGGAAATGTAATATGGCAGGTTAAT
AGACATTGTTTGTGTATTGAAAGATTGTAAGGACTTTCAGTCGAGTAACAAGGTATCTTCTGTAGTCTTTGCAATATCAATCAAGCAAAACTAGTAAAAG
GAAAATGACGTGGTGCGCTTGCATTGCCTGGAAACGCCGGTGCCACTTAGGGCCTTACTTCGATATTCAGGTTGCCGCTGCAACAGCTTTGCTGGGATTC
ACTGCTGAGATGGGGACCAAACTCAAGTTTCCTCCCGATGAATGCGCTCCTAACGGCTCCGACGGGAGTAAGGCCTTGGAATCCGAATCATAACAACCGT
TTAAAGACGGATCGAGTAACGCTTTGCAAATGAATCTATGATAGGAGCCACTTCAATAAGATGAGCTGAACAAAATGGCAGAGAAGGCCATCAGCGCTGG
CAGAGAAGTTGCTTCTTTTCGACACTGCCACGGCAATAGGCACTGCAAGGCTAAGCATTTGGGCTTGCTCTCTGCTGACTAATGCACCGCAGTGTGTCGT
AAACTCTTTGGTCCAAAAGCTTGACCAAAAGTCGACGCTCTGTACAAATACCAAAATCAAGTCTTAGCGATTCAGAAAGTTTGCAAATCTCATGCCTTAC
TAAATCCAAGCATAACGTCCCTAAAAAACTGCACATTATAACATCTAATCAGGCACCCTATGATTTCCCCCTAGGTATCTTGCTTTCAGTATAGACATCT
TTGCCTCATGTCTATGCAACACTCCCTCTTCTATGTGAAATTTCGCAGAATGGGAAAAATCTGCTGCATTTTCGTCGCCGAGTCggcgacgtcgacgtcg
gaagaaacagcttcaagcactTGCATGCAACTCCAGACCATGCTCTCCTCAGTGTATAATGCTGCGGAAACACGTGCTGCTTTGCTCCACTTCAAATGCT
GTGTATTACAATCACCACTTCAAAAACAAGTTTTAACGACAGAGCGAGCAagagagagagtgagagtgagagagtgagagtgaGAGCAAAGCGCCAGTCG
CCACTTCGGAGGAGCGTCATCGTCCGCACCAGAAACACTAAAGGAGTCAGCGCGTGGAGCTCCTCGAACCGGATGCCAGAGCTCCACTGCTTCCCATTCC
ACGCACTTGAATCCAAGTAAATTCACTTGCTCCATTATTTAAATAGTGGTCTCTAT