Description :
From Genome Similarity Track
Location :
Scaffold_25:322401- 326092
Transcript NameFunction/comments
Phyin_T30-4PITG_12934Putative uncharacterized protein

Sequence
3691 bases(100 bases per row)
AGCTTCTCTGCCAGCTCGAAATTATTCTTCCGACGTATTGCTTGCTCCTCCATCTCTCGTGCTGCAGCTAGAGCTTTCTTCTTGCTACGAGCTGCAGCAT
TTGCACTTGCTGTCGCTCGACGTCGACGTGCAGCACTCGTCGCCTTGTCGAGCAGATCTGCACTCTTCTCCTGCTTGTCAGTCAGGATAGTGTCGCGTCG
AGATTCTTCCCAGCGCTTCTGGTCTTCAGAACGTACGCGAAGACGTTCACGAAGCTCAGCCAATGACATTTCTTCCAGCAGACCAAGCTGCGCTGTCTCC
GTGGGGTCGAACACAGCGACGTGTTCGCGATGAACTTTGTCTAGAGCTCGAATCTGACGGATCAAGTCTTCGCGTGCTGCTCGCTCCTTGGCATCTTGCT
GAGCTTTACGGTCTCTTTCAGTAGCCAGGAACTCCAGCAAGGCATCACGTTGTCGTGCGTTTTCTTCTCGAACCTGCGCCTCGGCTTCTCGCGGTGCAGT
GTCACGTACACGCTTGACGTCTTCAGTAAGATGTCGGTACTTTGCTACCAACTCGTTCTCTTCTTTTTCACGCTCGACAGCTCGCGTATTCGCCTGTGTC
TTCATCTCGATGGCCACCTCTCGATTCTCCAGTTTGGCTTGGCGCGCAGCCTCCATGGCGTCAAATTGCGCTTGAACCATCTCGAGTCGACGAGTCTCCA
CCTCACGACGATAGTTCTCTTCGTCCTGCTGCTGCATATTGGCTTGCCAGCGGTAGAACTCGAGGGGATCACGCAGCTCCGACTCGTACGCGCGGATTAC
AGCTGCTTCATGCTCTTGCTTGCGTTTAAACAAGGCATCTTCACGCAAGATAACGGCCGCTGTAAGCTTCACTTCGGCTGCGGATGTATTGGTATGAGGA
ACAGGTTTGGCCTTAAAGTCGAAGTGCAGAGCTGCGTCTCGCTCGCGCTCTATTTGTTCCCGTACTGCCTCGAGGTTGCTGCCGCGAGCTGCAGTTGCGA
ACTGAAATTCGTCGGCAGAGTCGTATTTACTCGCCACTTGAGCCTTCATTCGCTCCTTTCGAGCCTCCTGTTGAGCCTGGAGCTCTGCTAGTGAGAGCTT
ATTTAAGGATGCAGGCACTGGGTTTGCCTTGACCTCGCGGGGAATACGGATGGGTTCAGCAGCTTTTCGAGGCTTCGGCTGAGTAATGTTAGGCGCCACA
GGTACAGTTAACTTCTTGCTTGACGTCGAACATGCAGTGACATCAGGGGAAGCAGCTCTTCCGAAGGCTTTAGTACGGAGTTGGCTCAACAGCTTGTCGA
TCTCTGGCTTAAAACTCAGCATTTTGTCAATAATTTGTGTCTCAACGAAGTCGGTATCAAGCACACGAGTCCATTGGTCATGCAACGTTCCTTTAAGTTC
CTCTGGATTAAAAAGATACGATAGAAACGTGTGCATACTTGTAGGCTGCAGTGCCAGAGCCAAACCTGCAAACGCAGTGGTACCTAGCTCTTCGAGACGA
AACATGGCTAGATACCCCATGATGAGAAACTTGGTGTAGTCGGTACGACTTACTTGACCGGAATGAGAGTCGAGAAACAGCGAGAGCATGGGTCGTAATA
ACTCTCGATAACGATAAGACCCGTACAGAACCTGCTGGAGGAACTGTTGATCGCTCGTTGATGATAATCCTCCAAGTTCTTCTGTCGCATGGGCGTCGAC
GGTGGTCTTTGCAGGGTCAAATGACTTGATCAGCTCTTCGCAAAGGGATAGCAACTCCTTTCGCTTCATACTGCGTTGAAGTCTTCCACGATGAATTATA
CTAGGTCAGCCAAGCTACTCCTAGAAGCGGCCGTCCGATAAACAGATAGCTAAATATGGATATAATCGCCCCCCTGTGCGCGCCACCACTAACCTTTATT
TACCCTCAAAATCTCATCACGTTTTAATGAAAGCAGGTCTTTAGTCTTTTGAACTTACTTTTTTCCTTAAGTCGACAAACGAGATCTTTCAAGAGATTCA
CTTTAGAATCTGCGCAAGATGGTAGCTGTAACACTGATCTGTGAGCCAGCTGGAGAAGGAAGCGTATTCTCTGTCGCTATTGGTACGAACAAGTCGGTGG
GCCAGCTAATAGACGCGATCAAGTCTCATCGCTTAGAGGCGATCACATGCGATACCAAGGATCTGCAGCTTTTTCTTGCGAAGAAAAATAATGCGTGGTT
GCAAGACGACGCAGCTTTACGACGAGAACTTGACACGTCCTTTATGGAGCTGAGCGATTTGTGTAAGCTGGAGAATCATTTTCTCTTTGGGCCAAACGTC
TCACTGGGAGAGAACGTGGTTCACGTTCTGGTTGTGACTCCATATGTACCCCACCCAGCTCGTCTGGAGAGATGGAAGAAACTAAACAAACTTCTCGATA
AAAATAAGAAGCCAAGACTCGCTAATGCTGACGAGACCGATGATATGGAGACCACGTGTGACTCGTACGACAGCGAGAAAGTGACGACAGGTGACAACAT
AGCTACTCCAGATATCTACCGAGGACTCCACCCTACTCGCATACTACGCTGGGAAAAACTGAATAAACTTCTCGCGCGCAACAAGAAGGCGATGGATAAC
TATTGTGAGGACACCCCCAAGGTGGCATCCAGCGGTGACTCGTTTGTTTCTTTTGAGGATTGTGAGAAGATTATGGGGACGAGCAGCTATAATCAACCGT
TGAAGGTCATCGCGGACGACAAGATCGACGTACTCAACGCATATCTCCTTGTCGCGACCAGAACGTTGGGTGGATGCTTACGGGGAAAGACAAGCTCTGG
ATTACACAACTGTGTGTAGGGCGGTTGCTTCACTATTGGTTTTACATATACAGAGTCAGTAAGGAGCTTAACATGTGTCAGTAAGGAGCTTAAGATACTC
TCAAAGTGCCAGAAAAACGTGTTTTTCAATGTGATCGTGTTGGAGCGTCAGCGTCGTTGACATCGACGAACAGATCCAGTGTCATCAGGGAGAATCTGGT
ACGTACTACTCGTTGGCCCACTGTGTCAAGTGGACACAGGTCACAGTGCGATGAACACGGGCGACAGAGTGGCTCCAGCACTAGCGACATCAACGGGATC
GACGTGGGTATTTCGACGTGAGCGATGAGAAGGCTTGGACAGGCGGCTCGGGCAAAGGGGACTCCGTCTGCATGTAGTGTCAGTTAGTTTTGCATTTTAA
AGACCCACCAGCTCAATCACTTTCCAAAACACCACGACGAGTACAAGCGCCTTTCCGCCTCTCCGCAACCCTCCTTCCTCCAAGTGTCAACTTCCGACAG
GTTATGACGTCCGCAACTACGGCCACGGCGTTCGCGACGAAGCTGAAGCAGTTCAGCAGTACTGGGTTCCCAGCGTGGGGCGCCCAGGTGAAGCTGGTCC
TCGAGATCAAGGGACTCTGGGCTGACGTCGAGAAGGATGCGCCACCGGCTGACAGGCTTGCAGCGGAGGCTGAAGCGCTAAAGGTGTACGATGCGGCTGT
CGCCGCTGGAACGTCCGGGACGGTGGCTCCGAGAACACCACTACATGAACAAGTCATGCGGCTGATGATGGCGTCATCGATCATCCTGTCGGCGCTGACG
GAGAAACTGGCAGCGGAGGTGTATCTGTTTGATCACCCGCTGGCCGTGCTGCGCCACCTGCGGCTGACCTACAACGTGAAGTGTAGTGCCA