Description :
From Genome Similarity Track
Location :
Scaffold_144:32240- 34131
Transcript NameFunction/comments
g18437.t1hypothetical protein

Sequence
1891 bases(100 bases per row)
ATGCTCAATTACATCCGCGAGAAGCGGCAGCTCAAGCAGGAAACTGTTACGGAAGCTACTGGAGAGCACGAGGCCAAGTCGGAGGAGAAGGGACCTGCAC
TAGACCCGGCAATGGCCGTCAAGTCCGACCCTTACCTTAAGATGCTGCAGCAACGGAGTTTACGCTCCGCTGGGCCAATTGCAGAAGACGGAGAAGCTTT
GCCCAAGCACCCGAACAGTGCGTACGTCGCGCCCGCGGCGGTGCCGCACTACGCACCAGCCAAGCCAAAGTATAAGCCTCGCTGGCAGGTCGCAGAAGGC
GAGTTTTTCGAGAAAATGTGTGCCTGTGGAGTGAAACATGACACGGGCAAGAAGGGCAAGAAGGCGTCGTTGAAGCTGCACACCATCAGTGCTATGATGA
GCACTTTCGGTGATAGCACGCAGTCCTGTGTGACGGCTGTGGAAGAGGTGCAGGCGCTGGGTGAGTCGTTGCAGGTTTTAAGGATTGGTGGTGGCTGTTC
TGATGATGTGGTGTTGTAGTTGGTGATCACATACGGAAGGTATTGGGCTCAGTGGATCCGGAAGTGCTGACAGCGTCGTCGTGTCTGAGGGTAAGCTGCG
TTGGTGAAAATCGAGTGTCGAAGTTACTTGTTGATATTTTGCTGACCTGTGATGATTTGGTAATTGTTGCAGACATTAGTGGAAATCTTCGAGGAGGAGG
CGATCTACTACGGGCGCTGGCGAGAGTTCCGCGGAGAGACAAAGCACGAGGAGAACGAGCTGGAAGATGTTGAGGAAGAGGCGCTTGCAGAGGAGCTCGA
TCTCTTCGCCGTGTCTGAAACTGATGCAGTGTTCAACGAAGCATTTCTGGTACGATGTGTCGTTGATGGATGAGCCGAAGCTTGGACTACGGCTAATTAC
TGGTGTTCAGGAACGGATACGATTCGCAGACGAGCGCACAAAAACGATGGACTGGTCCATCTACGACGTGTTTGCTAGAGGACGCAAGCTGAACTTCATG
AACAACAAGGCGCAGCAATTTCGGGAATGGCTCGGCCTTGGGAAGATGTCGCGTGCATCGCTCGAGTTCCTCAACTTTGTCACTTACCACAAGTACGCCT
CGCATTTGTCTGAATTTGAGCATGCGGATAACGAATTGCTAACCGTTTTTCTGCTGTCGTGGGTATCTTGCAGCATTGGTCGGTTAGTGGAGCTGGCGAT
CAAGAACCGGACAGGTGGCGAGTTGAAGCAGCTGGAGACTCCACTGCTGAAAGATGACGTCGAGTACGGGCTGTCGTCAACTCTTGTTCATGAACTTGGT
ACTTATTCTAATGGCCCCATCATTTGTTTTGTGGTTGCAGGTCTGTAGCGCTCACATTCCTTCCAGCCCAGCGTCTTCCAAAGCTCATCGACCGAACCCG
CCCACCAGCCACGAAAACTCGACGAGTTGGAGATAGTGCTGGCAACAGCAAGAGCGTCCGGATAGAGCCGAAGGCCCAGACAGCCTCTGAAGCAACAGCC
TCCACGTCAGCAACAACGGGTGCAAGTGGGAAATCGGAATCGGAAGGAGCGATCAAACCTAGCGTCGCACCGGCGGTCGCTAGTGCCAGACCAACCAGGC
TCAAGAGGTTGCGCTAAATCCACGGCCCTGTCAGTCAAGACTAACCAGCAAAGGTGATGCGGATCCCAAACCCGAATAATGACATTGGCAAACTTACATT
CTCACACCGTTTCGCCGTGTTTTTGAACAGTTTTTTTCAAATCAGTTGTGTATTTCGTCATGGTCTCGGTTCGGACGCCTTTGCTCACTTGTGTGCAGGT
CGTTTGGCGCGAGCGGCAGGAGGCGTTGGGCTTCCTCCCGCACGTTGCAGCACTCATCTCTGTGTATTTGGACGGCTCCCAGCTCTGGAAC