Description :
From Genome Similarity Track
Location :
Scaffold_1956:3223- 4365
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1956-snap-gene-0.3Gene of unknown function

Sequence
1142 bases(100 bases per row)
TGCTATATGTTTTGACATCTGGCGCTTGATGCTCGGTGACGAATCCTCCTGCGATGGTCAAGCGGCTGGACATCAGGCTGAAGCCAGCTTGAAGCCGTTC
AAGTGTAACACGCGCACGTATAGACCCTAGAAGTCAAGCTTTCTCGAGGGCTTCAACAAGGAGTTGGTGGCGCTTGGATGGGTCTAAAAATATGCGCAGA
GCAGGTGGGCTTGTCCAGCGATGCCAGTTCACAAGACGCACTCGAACGAGATCCGCCAAACAAGCGACTATCGGCCGGTTAATGAGATGACCGACTCGAT
CGTCGGCGTGATGCCGAACTTGAACGCTGCTTTGGAGTACTGCAAGGGAAACAAGAATTACGCAGCTGTCGACTCCCTGAAAGGATTTTGGCAGCTGCAT
TGGCGAAGCGAAGCCAAGAGATACTGTCTTACATGACGGATAAGAAAATCTATACGCCAACGCGGTTCTCTCAAGGATCGAGGGACGCCGCGCTCCTTTT
CAAGCGACTGTGGAGAAGGTGTTAAGCGAGTTGCTGTACAATAATTAGCTCGTGTGGGTTGACGATTTGTCGATCTTCTCGGACTCGGTGGAAGAGCTGG
TGAACGTCATGCAGCGAATATTTGAGCTCTTTGACCAGCACGGATTTAAGCTCAGCCTGATGAAGTGTGAGCTTTTCCTCACTGTAGTCAAGTGGTGCAG
GCGCGTCATTAATGAAGCTGGCGTGAGTCATGATCCCAAGCGGATTAAAGGACTGCATAAGATCCCTTATCCTAGAACAGCTGCAGAGTTGCAGCAGTTT
ATCTGTGCGACGAACTGGCTACGTGAAGGGCTGGTGGACTACGCGTGAGTGGCCAACTCGTTTCAGTGCTACCTGAATCACGCTCTGAATTGAAAACGGC
GAACGAAGGCATCGGCGACTAGTGTAGCCATTGAATTAAGTGCTAAGGAGAAGCTCGCTTTTGACGAAGTCAACCAGCTACTCTCGCGCTCCGCCACGCT
TACGTTTCTGTCGCCGTTGTCCCAGACGTGCATGCTGACCGACGCATCCGACAGAGGCTGGAGTCTAATTGTAACTCAAGTTTCCGATTAAAAGCCGACG
ATGCCGATCCAAGAGCAGAAGCATGAGCTTTTGATCTGCATG