Description :
From Genome Similarity Track
Location :
Scaffold_79:32228- 33790
Transcript NameFunction/comments
Phyag_g1699hypothetical protein PHYSODRAFT_298513

Sequence
1562 bases(100 bases per row)
ggagaagcagcgctggGCAGGCGCCGAATTGCTCGTGTGCGCTATGatccaattgctgctggtgaatGTGGCCTATCGCATCGACCGCATGCGCgaggcg
ccgctgctgtccacgtcgtcctgGGCCATTTTCTGCGGACTCGTCAGCGGCGCATTGCTCGCACTCGTGTCGGAAGTGGTGCGTGCGTCTTGTTCAACTG
CTATTTGGTGCTACGTAAGTAATATCTAACCTTTGCAATATCTATTGCTCTTTCTCTCTGTTGTCAGCGCGTGCAAGACGCGGGATTGGATCCCCAGATT
TTGTTCCTGGGACTGCTGCCTCCGATCATTCTCGAGGCAGGCTTCAACACGCAACGCAAAGGCTTCTTTAGCAACTTCTACGCTATTTTACTATTAGCAA
TACTTGGTACTCTGCTGGCAACATTTGCCACTGGCGGCATCCTCATCTGGCTCGGGAGCTTGGGTGTCATCACGCAATTGACGTCCGCCGAGGCCTTCCT
GTATGGATCACTCATCTCCGCCATCGACCCGGTGGCCACACTGTTAGTGTTTAAAAAGTGTCGAGCGCCGCCATTACTGTTCAATTTGGTCTTTGGGGAA
AGCGTGCTCAATGACGCAGTGGCCATTGTCATCTTCACGCTCTTCCAGAAATTCGTCGAGAGTGGCAACAGCGACGTGAACGTCCAAGTGGCCCTGTACA
TGGTGTTCCGACTGATTAGTATTGGCGTGGGCTCTGTGGCTCTGTCTGGAGCTATTTGCTACTCGTCCGCCTACTTTTTGCGTCATTCGGATCCAGCGCT
GCGTCAGCACCCGATCTACGAGATGTCTATCATTCTGCTGAGTTGCTACGCGAGTTATTTAGCTGCGGATCTTTTTGAGCTCAGTGGACTGCTGGCAGTG
TTCTTCAGTGGTGTGTTCATCCGTCACTACCACATGTACAACATCTCGAAGGCCAGCGCGTACGCTTTCAAGCAGTTGCTGGCCACGATTGCGTTTTTGG
CCGAGAACTTTATCTACCTCTATCTGGGATTGAGTGTGTTTGCGTACCGCGACTCGTTCGTATGGGACTGGAGATTCATTTTCGCCAACTTTGGCGCGTG
TTTGCTGGCTCGTGCGATTAACACGTTCCCGTTGTGTTCGCTGGCCAACCTTGGACGCTCAGAGCAGCAAAAAATTCCGTTCTCGTACATGATCGTCATT
TGGTTCTCCGGACTTCGTGGAGCCATCGCCTTCGCGCTGGTGCTCAATGTGTCGACGGGCAACCCTCTCCACGCAGCGATTCTCAAGAGTTCTACACTTT
TCTCGGTACTTTTCACgaccgtcttcttcggcatGGCCACTGGGCCGCTGTTGCGTATTCTGGGATTGACGGGAGAGCCTACGACTGAGCAAGAAGTGAT
TATCAGCGAAGAGATGTTCACTAATGAGGTTGACGAGGAGCAGCCACTCTTGAGTACTGTGACTTCTCCACCTGGTTCTCTGAGTGTGCACAGCAGATGG
GTGGAGCTTGACGAGAAATACCTCAAGCCCATATTCGGTGGAAACCCACGCCCGAGAAGCGA