Description :
From Genome Similarity Track
Location :
Scaffold_6:3220546- 3222464
Transcript NameFunction/comments
Phyin_T30-4PITG_04828Putative uncharacterized protein

Sequence
1918 bases(100 bases per row)
AACTTACATTCAGCTTTGCAGTGAGCTGCAAATTCCCACCCTGACTCGATCAAGGAATCCACAACAGCAACGATCCACCACCAGTACCCGGGAGACCCAG
AAATCCCGAACGCCATCGATCGAGGTACAGGGTTTTTCCTCCTAACATCGTCACATTTGATCTCTACGTCACAGTCTTCCCCGCTGGGACGTCCACTTCA
TCGATTTTATGGCCGCCAGACCTGATATTCACGGTCACATCCTCCGTATCATCGCTTTCAAATTTAACGTCGACACTACCGTCGCCTGCTTTTTTCCAGA
AACCTTCAGAATTATTGAAAGCGCGTTGAACAGCTGACAAGCCCAAAGCTTTCGTCGCATCACCATCATCGACTTCGCCGATGTACTCTGTTGGGCCACA
AATCGGTTGAAAATACTCGGAAATCGCTCCAGTGGCAGACCACGGGTCCCAAATGGCCCAGAAGCTGAACGCTTTATCCGCTATGTTAAACGCGTACCCC
TTGGCTTTAAGGTATGACCCGTTATTGCTTGTTCCCGATTTTATCAGATCATCTACGATCCCTCCGAACGTCTTGCGAAGTTTATCACGAGTGGCGAATG
CCGTGGCCTCGTCCGATTCCGCGATCAGATCGCCCATACAATTATTCGTAGCTGTCGGGATATCGTTAAGAACGAGATTTGACTTGCTGACCGCTACACG
AATGTCGTCTTCGGACATTTCTGGATTTCGCTTACGATATTCCGCCACCGTCATCCACGTTCGATCCAACACACGCTTCATGTCAAAGCCGCAGGTGGAA
TCGGACTTCATTGCGGACTTTAGTGACGTGATGTCCTTGGAGCCCAGTGGAGCCAACAAGTCTGTTTGCGTCATGTTCATCATGAAGCCGGTGAATTTCT
CCCAACTGGAAAGCATAGCTGCTCCATTGGCCACGACTTCCTTCAACACATACTCTGCGGTCATGAGTACACTGTCGACAAACTTGATCTCGTCAGACGC
GGATCTTCCGATGCAATACGACACAGCGATGGGGATATTGACGACGACGTTGTCTGTCTGGTAGAGCATCGCAAGTAGCTTGTCTTGAGGTGTCTGTGGT
TCAGTTACCATGATGTTTCGAATATACCTCGCCAATGCCTTGATCAAACCCATCGTGTACTTGGCACATTTAATAACCACTTGGACAGCTAGAGCTAACT
TAGAAAGCTTGCCAAAGACGTCGTACGTGATGAGAGACAGAGTCGTCTGAGCCAAAGCTGAGACCTTCGTGACGATTTCGAGCACACAGTCGTCATTCTG
TCGGGTACACTCCATCCCACACTGCACAGGGAACGAGTACGGACATTGCGCCCAGCATGTTCCAAGCTTTGCGTTGAATCCCACCGGACACGTCTTCGCG
ATGTGAGCTTTACGATAACACGCTGTAGTTTTTGACGTGTCGAGCGCTGTGCCTACCCAGTTGACGTACGTTGACTCAACCGTGCTGGTGGCATTAAGAA
CTCCACCAAATTTTAGAGCCGCGCTCATGGCTTTAGACAACGTATCCGACATTGCGTCGTCGCTCTCTGAACTGTCGTCATCGCTATCAGATGAGTCCTC
ATCGCTGCCCATCGAATCGTCACTGTCTTTCGAGTCGCTATCGTCACTGTCCATCGAATCCAAAGAATCGTCGCCAACGCCGCTTAATAATGCCCTCAAG
GGAGACACTGTCGCTACTGGTGAGTTAATCGTTGTCCAACTACTTGGTGTGCGAGAGCTAGCGGCGTGGAGTGTTGATGAGGACGCTGTTATGCTGTTGA
TTCCGTATGCTTTCGGCGAGCCTGATACTGTATTTCCACATGATGTACGAACAATAAATGCAGCGAGTATCCTGAGTTTCATGCCTGGCTTCCTGCTATA
GCGGCAAAACGAAAAGTG