Description :
From Genome Similarity Track
Location :
scaffold_213:32204- 34381
Transcript NameFunction/comments
g5757.t1hypothetical protein

Sequence
2177 bases(100 bases per row)
CGATTCGATCCACTTCGTATTCGGCCTCGTCTAACTCGCGTTCCCATCTGTCTTTCGGCACGAACGCTTCATCGAAGTTCACAAGACCTTCCCCGGGGAC
AACGACCTCCAGTTTCGGCGGATCAAATAATTTCTTCACAAGCTTCGACCCATGCATGATTGCTAAGATCCGGTCTCTGGTCCCCACGACTCCCAGCTTC
GCAGCGTGTTGATCAATCATCTCATCAGCGCGGGATGACCCATGCCAGAGGTGTGCGGGCTTCCGAGCGTGACCAACCTTGACGCGGTCCCGATACAACC
AGACGTGACCGCCAGCCTCGATGTGGTGTGGACGAATATCTTCGTTGTAGTGGTCGGCCCGTCCGCAGATCCCTTGTCGTAGACGTTCGGTCACGTCTTT
GCGAGCCCGTTGATAGTGGCTCTGCACCTGGTTACGCCACCTCCGTGGATCGCGACGCGTACTTCCGAACGGCAGCGATGCTTCCAGAGTTGATCTCGAA
TCCCAACCATTTACGAGGAAAAATGGCGTATCTCCCCTAGCTTGATCTTGGGCCTTGTTCAGCGCGAACGTCAACCGTTCAGCGTACTCGTCCCAGCCCT
TCCGATTTACGTCTGTGACATACATTTTTACTGATAGAGTCAGCGCACCATCCGATCTGCCGTTCCATTGGTTTGAGGTCGGTAAGCCATCGTCGGGCTT
TGTCGTTGACCCACAATACGATTGAACGCGCAGAATACATTTGCCATGAACTCGGGCTCGCGACCGTGTCGGATGATCTTGCTCATACCAAAGCGGCGGT
AGACAATCTTCCCATAGTTCCCGGCAATCCGTTGCGCAGAACGGGCGTTGCTCACATTTGCTAGCACATATCCGGTGAACAGATCTGCCCAGATCAAGTG
CTCCATGTTCCTCTTGTATGACTTCGGGTGCGAGGGAGTGCAATGCATAACGATGGTTTGGAACGGGTAAGTAGCCTGAGCGACCTTCCCTGAATGGTAT
GTCTTTCTTTTCCACTCTCGCAGTCAACACACGCACCCACATATCGTTGGACGTCTCAGCACAGGCCCCTCCAGTGGAAATGCTGTTTCATCCGCGAGTC
AGTCTTCCGATCCACTGATGCCCGCTCTCCAGGCTCGCATGGTAGTGATGCAGGAAGTCCTGACGGAGCAATTCTGGGATCACCAGTTTGGCAAATGCGT
CACGAACTTCGTCATACTTAGGCGTGGAGAACGGGCAATACAACTGGAGTCCATCACCGTCTACCTCACGCGCATCACCGATAGTCCAGGGTAGGTACGT
TTTCAGATCGCCAATCCACTTCTCCACGCCTTGTGCCTCAGCGATGAGTTCTAACCTCATGCTTTAAGCCGCCGATTCCTGTTGGCATTCTGGTGGGGAT
CGCCGCCGTGTGGTTGATAGAGTTACTGTCGAGACGTGAATCATGCTGTCTTCGTTCTTTGCTTGAAGATTTATCAAAGTCGGTTGAGCGTGACTAAGTC
CTCGAAGTTCCCCATCGACGTTACGACCGTACCTGGTTCTGCCTGCAGGGCTTCGCTGGCGAAACGATCTGCACTCTGACGTTTTACGTGTACAAACTCG
TGCCAAGGCCACGATGAGAGTCTGACCATCGCTTTCTCACGCAGGAGTTGCAAAGCTGACGCCTTGCATGCGATCCCACCGCGCATCTGCCAGATCACCA
AGTTGGAATCTCCGCAGATCACCAGGCGCCCCCTGTCAAAATACGACAGGAGATCCAGACACAGAAGCAGCCCGTGGTACTCGACTTCGTTCACGGTCAT
CTCAGATGCGTACTCCGACGCCGCCGTGAGGACCTTCCACTCTGGCAACTTCCAGACAACAGCGCAATAAGCTCCCCCGCCACGTTACACACGGGAGGAT
CTGTCGAAGCTCCCGACGGCCAGCTCTTCATCCAGTTCGACCATTCGTGTGGGCACGACGATTATTTGTCGAGGCGGTTGCCTGGGGGCGATTGCCACCA
GACCTTCGTTCACCTCTTCCCGAGGGGTAATTGTCGCCCCCAAGCCTTCGACATCGCCCTTCGTACACCGCACGATCCCCAGCGTCCATTAAGACAGTAG
TGCAGCCCATGAACTCAGCCGACCCAAAAGGCCGGAAGATCAAAACAACCAAGCTAACGTCGAGTTCCGCGACAACA