Description :
From Genome Similarity Track
Location :
scaffold_1001:3220- 5404
Transcript NameFunction/comments
Pl_101597hypothetical protein PHYSODRAFT_301780
Pl_101598hypothetical protein PHYSODRAFT_346539

Sequence
2184 bases(100 bases per row)
CTCACAGTCTCAGACTGATAATATTCACGAAGCAAGAGGCCGTTTGCACGTTCCGTTCACGACCTCGCTGAATAAGGAGTGCTGTAACGCTGCTGATATC
ATTGGTAACTTCTTCCGCAATGACTGGGGTGCTTCCGCAGATCGAGCGATTCCAGTGGCATTTCTCCAGAAGGCTCACGGTCTTGCAGTTATGACTGTTA
TCAAGGCTGGATTTCTTGTCTCGGGGAAGATTGGTACTGGCTTGGTTGTTGCTAAGCTGCCAGACGGATCATGGTCGGCTCCGTCGGCCATTGGAACCTT
CGGACTCAGTGGTGGTTTTGAGCTTGGTGGTGAACTCGTGGAGGTGATGATTATCCTTGGGTCAGAAGGAGCTGTGAAAGTGTTTCATAAGCCTCAGGTG
AACCTTGGTGCTGGGTTGGACATTGCTGTGGGCCCGTACGGTCGATCAGCACAGGCAGCAGCTGCAGCCAGCACAAGCGGTCTGAACGCCAACTATAGCT
ATTCGCAGAGCAAGGGTCTGTTTGCAGGTATCTCGCTGCAGGGTGCTATCCTGGCTGCGCGCTCGGACTTGAACCGCAAGTTTTATGGCCGCGATTTGCA
GCCTAGTGAACTGCTGAGTGGTTACGTAGAGCAGCCCACAGCGGCACGTCCACTATACGAAGCTATCGACAATGCAATGCGAGGCATCGAGGACCACAAG
GAGGAACAGCAGCGCCGTTCATCGGTAATGGGAGCTTGCAGACTCTGCAATTGTCCCATGTTCCAGGCACACACGACACAGATTTGGAACAAAAAGTGCA
AAACATGCAACCACGCGCATTAAGAAAGTAGGGTACTATGCAAAGGTGGTCAGGGAGGATACCTAATATTAATGCATGTGTACGAAAGCAAACTCGCTGG
GTTATGTAAGAAGGTATTCTCTGTGGACTAGATCTACTCTTGAATGTTACGACAAGCGAAAAAAAAAAAAAAACACACCTTGAACAAGCAGCGATGAGCC
TATCTTCAAATACTTGTTGAATATTTGTTGAAGTCAAGGACATAACATATTGATATGTACACATACAAACTGGAGAATGTCCTCAAGCCTATTCAATAGT
AATAAGGAGTGGCTTCGCAGTCTTCACATGCTGCACGAGTTCTTCTTCGTACTTAGGGTTCAACTTGACGTGGATAACTTTACCTGGAGCCGCAGCACCC
TCCAGCAGCTTTACGGCCATCGGATTGAGGAGATGCTGCTGAATGAGACGCTTGAGTGGACGCGCACCGTAGAGTGGACTGTAGCCCGCGTCGGCCAGCC
AGTTCTCAGCTACAGGGTCCACTATCATCGTCAGCTCCTTCTCCTCCAGTAGCTTGTCAACCTGACGTAACTGGAGATCTGCAATTGAGAGAATATCTTC
GCGTTTTAGACGATTGAATAACACCAGTTCGTCAATACGGTTGAGGAATTCTGGTGTGTAGTGTGAGCGCACAACGCTCATAACGTCGCCTTCAGCTATC
GTACTAGGGGCTCCCTCAGGCAGTCCAGCGAGAATATCTGAACCAAGGTTGCTCGTGAGGATGATAACCGTGTTACGGAAATCTACGAGACGACCTTGTG
AGTCGGTTAAACGACCCTCGTCGAGAACTTGCAGCAAAATATTGCTAACGTCGCGGTGTGCTTTCTCGAATTCATCAAAGAGGACCACCTGATAGGGACG
ACGACGCACTGCCTCCGTAAGGGTACCCCCCTCCTCATACCCTACATAACCGGGTGGAGCACCCACAAGACGGCTCACGCTGAACTTCTCCATGTACTCA
GACATATCGATGCGAGTGAGTGCTTGTGGGGTTTGGAACAGAAATTCCGATAGCGACTTGGTCAACTCCGTCTTACCCACGCCAGTAGGGCCCAAGAACA
TAAACACACCAAGAGGCCGGTTGTGCGCGTGCAGGCCAGCGCGTGCGAGACGAACACAGTTACTTACAGCCTTGACCGCATCTTCTTGGCCAATAACGTG
CTGATTGATATGGTCTTCCATCTTAAGCAGGCGTTGCTTCTCACCTTCCATCAATGTCGATGCCGGGATTCCAGTGGTCTGGGCCACGACTTCAGCAACA
TGATCAGCTGTAACTGCGTCCCCAAGTGAGGTCCTGCTTTTCCCTGACTTTTTGATCTCCTCTTCCTCCTGCTCTTCATGAGCT