Description :
From Genome Similarity Track
Location :
Scaffold_301:322- 2642
Transcript NameFunction/comments
Phymu_g8303hypothetical protein PHYSODRAFT_495108

Sequence
2320 bases(100 bases per row)
AACTCCTCATCCGTCAGACGCTGATCACTTGGTGTCAAGAACTCGTAACTGCTGAACACTGGACCTGCGAACATGGTGTTGTCCACGACAAAGAATGCCA
TCAGTGGATTTCCAAcgccgagatgaaggacACCTCCTGGGTCCGCGTCCATTGGTGATGGCGAGTCTGTATGGACGTCAACCacgatgacgtcgctctt
gccTGAGTCTTCACGGCTTTCAAAAACAGTCCCGGGTACCACCCCTCGTATTTTGATCCTCCACTCGCGAATCGCTCTTCCATGACCGTCTTTAAGAAAT
TCACTTGAGTCGGGCGTAACGGTTGATGTTGAGCCTGGAGCTTTGCGATCTCTTCAAGTGACTTCATCGTTTTCGCAAAAGATTCAAAAAATCTCCGGCT
ACGGTAGAAAAAGCCCTCGCTATCGGGCGAATGAAAGGGTCTCGTATTACTTGAACTACCAGGGTGCCATACAGAAAACAAGACCAAAGGCATCAACAGG
TTTTTCAGCATAGCACTCATTTGTTGAGCCAATTCCCCCATTCTCTGCCAGAAGACGGGATACGGATCCACCATACCGTCTGCATATTCACAGCAAAGAT
GAATAGTGCTGCCCTTCTTAGCGTAAAGCAAGGTGTCATGTCGTAGCTGAGTGAACGACCCCAACTGTGTATTCATTTGGCGCAAACGCCAAATATTCGA
CTGGAATGTGGGTGATTCGTTCGGAGACGGTCGTGACAGAGCGCGTAAAGCTCGTTGCCATAACATGCTGATGCTTGCTGTACCATGGACAGAATGCGCA
TCCTTGGTAAGGTCATCGTCAAATTCGTTGTCCATCAGTTGACGCAGTGCCACTAGATTCGACGAGAACGGGCTACCATCTCGGAACGGAACAAACTCCG
GTGAACCGCCACCTTTTAGTGGTTCATCATTCATCCGATCAGCTAAAATCTCAGCAGCACTGTCGTTCCCAAACAGAGTGAAGGCGACATCAACCGCGCT
CGGAATGCGACGCTTTTGCTTTTCATCTTCCAAAGGAACGTAGTCGGATACTAACcgcgagaagatgaaggaaCTCCAGACGAACCGCTGGCCAAGCACT
GTAAACGAGGTAGAAAGAGGTTCATTCTCAGTACGAGGGTGGCCGTCGATCAGTTGAGCTCCAAGTCCTTTCTGGAGAATTAATTCTTGGATGCTCTCCA
ACGGATTTTGATTACAATCTTCTGTTTCCACCGATAATAATTGAGCCAGTCGAGTAGGTGATAGCGAGTCGGCTCCTACTCCTCCATCACCCACCGGGTT
CGAAATCACTTGGTCAAGTCTCTCCACAAAATCCAGCATTTTTTATTCCTGTAGGCGATTCACCAACTCAACAGCGCAGCGTAGTTGGTGCAGATCGCAA
TTCGAATTTTCGCCACCAGCGATACGGAAGTCCATCGTCCCGAGCCAGACCAGGCAGCGAAAGTACCGCATCAGCAACTCAGATACAGTGTAGTGTCCAC
GAGGCTTAAACTGTGAGAAGTCGACGTCACGCTTGGCCGACAATATCTCCACCTTGGCTGATTCTTCTTTATGGATCAACGTCAGCAAACATTCCAATTT
GTTGGTGTTTTCAGAGAGACCGCGCTCTGGTATCCCTCGCAACAGACTTAGTGTTActcggagaagcagctcaacatCCACCATCGCTCTTCTCTTGTCA
CTGTCATCCtttggagcagcagagaTGGCGGCAGCACATTTGGAAAGGGTTGTAACCAGCAATTTGTCCAGTGTGGGCGACAGTACCTGCCCCTCCACTT
CCACTAGAAAATTGTCAAAGCTGCGGTGCCATGCGTGTAGAATTGAGTCGGCAGTCACGAAGACTGGCATGTCGTCCGTGTACAGGTTATAGTAGATTTC
TGCGAAGCTCTTCGCCGGCATCCGCTCCACCGCAACGAAGCCATTGGATGCAAGTTTCGTCTTCTCATCTGGAGTGAGACGGTACTCGGTTGGCATCCTC
TTCAGCGGATGATGCCTCCTGGACTTCAGAATCTCATTGCAGTACGAATCACcgtgttgctgcttcgcttGTTCGCGTAGGCGCTCAATTTCCTTGCCAA
CCTCCACAGGATCCGCATCAAAGAGATCGAAGAACTTACAATCTTCCAGTACGAGCGGTGTATTGGTTTCTTTCCCGCTCGGAGGAGTCGGGTAGAGCCT
TGTGAGATCCTCAGGTGTCAACTTCGTGCCCACTCGCTTTAACGTGGCTTCAAACGCGGCTCCAACATCACCCCCACCCATGCTGAAtttgttcttctgc
ttcttggtctttcACCGCAA