Description :
From Genome Similarity Track
Location :
Scaffold_481:3219- 4816
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_481-snap-gene-0.8Proteasome 26S non-ATPase subunit 5

Sequence
1597 bases(100 bases per row)
GGAACTCTTCAGACACTGCTTGGAATGGCAGAAGGTAAAGGCTTGAATGTGCACAATCATGTGTGAATCGAACGAATATGATTGTTAACTGGTTGTTTGT
TTGTCTAAAACTCAATCAGACCCATTCGTTGGAGGAAGCGCGATTCGTCTGATCGGCGAGATGTCTGCCACTGCAGCAAAGCTGAATGTCAAGTCGTGGA
ATTGGGACGACCCTGTGCTGTCGAAGGCGTTTTTGGAGACGATCGAGAACAAGATTCAGAGCACCGACTCGTTGCAGCAAATCGCGGCGATGGACTCGCT
TGCTGCTTTTGGCTCGTCGTCTGACAAAGGTATGATTGTATCAACTTGTGACGTGATGTGAATTTGTTTTATGGATCTAACCAAGTGGTAATGGGTGCTT
GTATGTGTTAGAATTGCACCTCTTGCTGCAGCACAAGAACTTGTGCCAGTCGTGGCTTCGGCTTGGAGCGAGCACAAAAATGGAAGTGAAGGCAAATTGT
TTTCACTCGTTGGCTCGAATCATCGGAGAACCCACACGTTTGACGCGTACATCAGAAGAGATCCCGGCGGAAAATGCGGGTGTTTGGATGCTTCACGAGC
GTCTCTTTAACAGTCTCGGTCGGGAGTGCCGCAACCAGTCCACGCTTTTGTACCTGATGGAAATTTTGAGACAGCCATTTGAGGAGATCCGCAGCGCAGT
ATTCGTGTTGCTGCGCGCTGTCGCTGCTCAGAACAACGAGTGGGGCATGTGCGCGCTGCTTTCCTACGGCGGCTTCTTTGAGTTCCTCGTGGATCGCACG
ACTGAGCCAACGAAGGAGACCCGCGAGTGGAAGTTTTCTGTCGCGGATGCAGTGATGGTCTCTCCGTTCCGCTCGAAACTGGGTTCGTGCTGGGTTGTTG
TTTTGTTCGTTGAAAGTTTCGCTTTGCTTATTTTTTCTTCTTCTGTGCTGGGGATATATTGCAGATGCTGTGACACTGGAGAAATTGCAAGCCTACTTGC
ACAACGGTCCGTACGCGGGCGTCGCGCCTCCGTCGATGGACCTTGACGCGGCATAAGGCAGCGAGCGAGTGATGCCAACCGTCCAACAGATCGGTAAGTG
AGGGCTTGGCGTGGAAGTGGAAGCTGTGACGCCCAAGCGTGATGTATCAACAAGTGAAGCCTTGGTGCATATATGTGGAAGGAAAGGATTTTCTGGAGTT
TAATTTTGGACCTCGATGTTCATTCAGCAATGATCACTTTTGGATTTGATTTCACGAAATGTGTCCCAAGTAAAATCAGAAAACGATGCATGCTCGCTTG
CAATGTGGCGGCATTCACAAACAGCTCTTGAGAAATTATGTGTGGTGTGTACACACAACGTTTTCAGCTACGTTTGATAGAATGTACAAACAAATACCCG
TCAAATACTATCCCCTTGTTTTACCGATACTTGGAGCGACTCATTCGGGACGCTCGGGACAGGGCGGGATAGCTTGACGATTGCCGCGCGACAACACAAA
AAGCACGCGGGGGAAAGCGAGGCGGCAATCAGCATCAGTGCGTCAGTCGGTCGGCCGATTGTAAAGATTAGGCGCAACACCAAGACACACACACACG