Description :
From Genome Similarity Track
Location :
scaffold_48:321890- 331752
Transcript NameFunction/comments
g7504.t1 hypothetical protein PHYSODRAFT_350602
g7505.t1 conserved hypothetical protein
g7506.t1 hypothetical protein PHYSODRAFT_354328
g7507.t1 hypothetical protein PHYSODRAFT_354328

Sequence
9862 bases(100 bases per row)
GATGCCTCGCTTGCTGGTACTGTACGGCAGCGAGACCGGCACGGCGCAGGACGTGGCCGAGTTCGTGCAGCAACGAGCCTTCAACCGGCAGCTGCTGGAC
ACGCAGATCTCGCCCATGGACGCGTTCCCCGTCTCGCGGCTGCTGCCGCAGTGTTCCACCGTCGTATTCGTGGTGTCCACGACAGGCGACGGCGAGGCAC
CCGAGAACATGCGCAACGCATGGCGCAGCCTGTTGCGCAAGACGCTGGGGCTGCAGTGGCTCTCGGGCGTCCGCGTCGCCGTCTTCGGACTGGGCGACTC
TAGTTACGCCAAGTACAATGCTGTGGCGCGGAAGCTGCAGGCTCGACTGCTGCAGTTGGGGGCGTCGGAGCTCATTGACCGAGGTCTCGGGGACGACCAG
CACGCCTATGGATACTTCGGGGCGCTGAACCCGTGGCTGGAGAAGCTCTGGGCGGCGGTGCTGCAATTGCATCCGCTGCTGGAAGGAGTCCCAATCGACG
ACTCACCGAAACCGGTCGAGCCTCTCTACGCTGTCACGGTGCATGAGGCTGGAGCTGAAGAGGTGGAGGCAGCTCGACTTTTGTCGCCGAGAACTGATGA
GTCCAACTTTTATGCGCCACCGCGCACCGTGGTGGGGAGGGAGAAGGGCATTTATTTGGCTCCTGTCGTGGTGAACAAGCGGGTCACAGCAGGTGACTGG
GAGCAGGATGTGAGGCACTTGGAGTTTGATATTCACAGTGACTCGAGTGGTGGGGGAGGGGCTGGGGCCCCGTTCAGAGCTGGTGATATTGCGGTGATAT
ACCCTGAGAACGTCACGGGAGTGGACAAGATGCTCAAGTATACAAACATGGATGGAGAGACGGTCATCTCGATTAACGCTGCTGATGGCTCGAAGCAGTT
CGACCTGCCATCCCCGATCACTGTCCGTGATGTGTTCGCAAAGTACTTGGCGATCCTGGAGATCCCGCGCCGGAGTTTCTTCGAGAGGCTGTCTCTGTTT
GCTACAAATGAAGAGGAGGTAAGGCATCTCGTTTACCCCGCATAGCGTGTGCTTGAAGATTCTAACTTTGTGTAAATCTGGGTGATGCAGAAAGAAAAGC
TCGAGGAGCTGGCCTCAGCCGATGGTGTAGATCTGCTCTATGACTACTGTATTCGTGAGAAGAAGACGTACGCCGAAGTGCTAACGGACTTCCCGAGCGT
GAACGTGCCTTTGACGATCCTGTTGCAGCTCATCCCTCGTCAGCAACCCCGTTCGTACTCCATTTCATCGTCGGCTCTGCTCCACCCTGGACGCGTAAGT
TGTTCGATAGGATTCCTTCGATCATCGTTTGCGTCATACTTATCGGGTGTCCATTTTGTAATGTTATACTAGGTGCACTTGACGGTGGCCATCGTCGACT
TCCTGACACCGTACAAGCGCCGCCGTAGCGGAATTTGCTCATCATTCTTCCAGTCGCTGGATCCGTCGAAGGAGCAAAAACTTGTGCCAATGTGGATCAA
GAGGGGTCTCTTTGAACCCCCCAGCTTAGAGCGCGATGTGCTTCTCATCGGCCCGGGGACAGGACTCGCTAGCATGCGCGCGATTGTGCAGGAGCGCCAA
TTCCTGCGTAAGCAAACTGTTGCCAGTACTGGCTCCGGGTCAACCTTCCTCTACTTCGGGTGCCGTCATGAACACAAGGTGAGAACGCGACTTCGTGTGC
TAAAAGTCCCTCACCCATTTAACGAATCGATTGTTGCGATGTAGGACTTCCTTTACGGAGACGAGCTGCGTGGGCTTGTGACTTCGGGTGATCTCACCGA
GCTACACACCGCATTCTCTCGTGATCAGGTGCTCACTACCGTTCAACTATTCTCGTAAACCCGGAAAGCTGATCAAACTAATCGTATCTCCGTCGTACTT
GCAGGACCATAAAATCTACGTGCAGACACGACTGGCCGAGAACAAGGATGCCATCTTCGACTTCATCATGAACGGCGAGGGATGCATCTACATTGCTGGA
TCCGCGAAACGAATGCCGAACGACGTGTACGAAGTACTGCGTGACATCGTTCGCTCAGTCGGGAAGATCCCCCTGCCAACCGCCGAGAAGGTGATGAAGA
CGTTGGCTCGCAAGAAGCGCTACGTCGTCGAATCTTGGTCGTAGAAACCTCATGCAGGCTAGATCAAACCAATTCAGTAGACTGCTTGGCCATCTCGGTG
CACTTCACCTTTTATGATTCGCTAAAAACACACAGACCATGTCCATGGACACCGCGCAGGAACTGGAGCAGGCGCAGCATGTGCGCACGTTCGTGAGGCT
CGCCAACCTCACGCAGACGCCTGAGCTGCACGAGTGGAACCTCGAATCCCTTCAGAGAGCTCTGCAGTGGGCTCAAGTAGCGGAAGATGTGGTGGATGGC
AGGGAGGGCATCGAATCGCACATCCGTCGGTGGTTCCCCGTGGCGACGCTGCCGACGCTGCCTTTGGATGGGGCTCTGACAGCCGACGCCCTACGCCATG
CAAGCGTCCACTTGCTGCAGTCCATTCTGCAGAGCCCGTACATGGCGACGCATCCGACGCGGTCGGAACTGCTGGTGGCTGTGCTCCAGGAGCTCCAAAG
CAGACACGAAGACTCGTCGGCTGACGAGCTGGAAGAGCACTCTAACAGGTGACTTTGCTAGTGGCGCGGTGTGAGTGAGAGATCCTTATTTTGTTTTTTG
ATGTGCTGGTAGTACGTTGCTAACGGAGAGGGTTACTGGAGCCCCACGCGCAGACTCGATGCTAGCCATTGCTCGTCGAATGAGTGAGGCTTGCAAGCGC
ATTCGTGTGCAAGGTAATTGTCTCTGTCGCAATGTGGTGCAATGAGTGATACTGACGCGTTCGTGCAAATGAAGTGCTTTCTGGCTGGATCCTGGTGCCT
CCACTAAAGAGTTACGCACTATCACCACGCACGCTTCAGCTAAAGGCTATGGCGAAAACGTTGCAACGAAATGCAGTGGATGCTCGTGCGGCTGCCAACC
CCGAAACGTACCGAAAATTTCTCAATGACCTGCAAAGCTGTTTTGAAGTACTTGAAAGTAAAGATGTCCGGGTAAGCTTGCATGATGACTCTTTTTGTTG
GTGAAATGATTCTTATCAAAGAAATGATGTCATTTGCAGGAAGTTGTGGTGTTGATGCTGGTTATGTGCGAGTGGCCTGCGCAGGAACCTCCACAACTCC
GAGGAATGATGGAGGATCTTATGAAAATCGTGCGTGACTGGGTAATGTACAAGCCCATTCGGTACTGGACGTTCTCGCCGTGGTTGGCATCCATGCTGGC
GAACAAATCAGAAGCTCTCGCTCGTGCGTATGTAGTCGAGTTGTTCACGACAGGCCTTTTGCAACCATGTGAGATTGCAATTCATTGTCTGCACCAGTGA
GTCATCTATTGACTGTACATGTATTTTCTTACGCACTTTGCATTTACTTTAGGGGAGCGCGAGTTTGCAGAGCGTGTTGCGACGCTGGTTTTGCAGGGTG
AAGGTGTGCAAGTCGTACTTGAACCAGCTTTGGCAAAGTTGGATCCCCATTTGCAGCAAACCTACTTCAAGGTAAATGCAAGCAAGTAGTTGCGACGGAA
TTATCTCTTAGTTCCATGCCGACGCAGAACATCGACGACATCGTGATGATTATTGCGGAGTGCTAGGTCGGTTGCAGTGGGGTAAGGCACTTGTAGGAGT
GGCAATGCAGTATCCGCGCCCTCGCCAATCAGTGCAGCACAGCAGTCTGCGAATCCTTCTTCTCCAGCGATCAGCACTGCAGTATATCCGAAGCGATTAC
GTTGGTTGATCAGTGACCGAGTCCATACTTCGTCGAGGTATGACGATTGGCGAAGGTGGCGCAGTATCAGCTGCAGGGAAATTAGCGCGTTGGATGCAGT
TGCAATATGTAGAACTGAATTCCCATCGGCATCCGTCACAAGAACTCCTGCTCCATGGCTAGCGTATATTGATAGCTCTAGTTAGTAAATCTGTCCGAGA
CAAGTTCATCGTACGAACACTTACTGAAGAAGGTAGCTGGCAACATCGTGTGCATCCCAAGCGCATGCATACTGCAGAGCTGTGCGACCCGTGTGAGGGT
GCCGTTCGTCCAGCAGTGTCGGATTGTCGGTATAAAGAATGGCAAGAGCACAAACATCGTTGTTTCCAACGGCTTCCATCCACTGGTCCAGGAGCTCCAT
CTGATCAGTCGCGTGAAAATAATGATCAATTTATTAGGAAGGCACTACATAGTGCATGGCCCGGCATATTTGGTCGATACAACATCAGTCAGTGGTGAAG
CCGTACACCTCGGTCTCCAGCACCGCGTACAGCACAGCCTTCAACTCGTCGCGAACAACGTGCAGTGGCAGGTCCAAACGATTGAAACAAGCGTGGCTGT
GAATGAACCCGTCACCAATCAGCGACACGGCCTTCAGTGTAAACGGGCACAGACGACCATCGTAGCTCGTCAACGCACTGAACCCTCCGAGAGGAACGCG
CGATGAACCAGTTGAAAACTGCAGCAGCCGACGACGATACTCATTTGGCATCTCTCGCACTAGCTCCCAGAACCACTTGAGTGAGCGGTGGTGGTGAAGG
TCTTCCGAATACTTTGTGTTGCGCTCCCAGTCATCTACGTCGATCTCGTCGGAGCCGCACAGCAGGAAGTCGAACTCTTCCGGGTCGAATAGCAGGAGAA
GTTCGCGAGGGACGATTTCGTACAGGCCCTGCAAGAAGACTTGCAGTTGAGGGGCCACACTTTCCACAAGCAGGTATTGCCACTTGAGCTCCACGAACTC
GCGCTTGTTGGAATCGGTGACGGGAATGGCACTGCCGCCAGGCACGAGCTCGATATCGCGATAGCTATCTCCATCCTTGGTAGTCACGGTGAAATCGAGA
TCTAGCGCATCGACATTGTCGTTCTCCAGTAACCAACGCAAATTGCTGTACACCTCTGGGTCCAAGTCCTCCAAATCTTCAAAACTTAACGGGTACCCAG
AATCAGCTTGAGGAGAGGTGAACCAAGTGGAAGCACAGCATAGAACCTTCGAGCAGTGCGCGACCCAGGAGACGGCCGGCCGCATACAAATGCAGGAGTC
GATCCGGCAAAAGATCCATGTTTGAGCAGGGGCTCAAAAAGTAGGCTTGCTCATTTTTGTTGGCATATACAAAGAGACCGCGAGCAGGATCCACGAGCAT
CTCGTTCAGCATCACGAACCACTCGCGATGAAGTCCTCCCGCATCCACTCCACTTTCATCCAGGAAATTAATCCGAAGCACAGAGTGGAGGTTCGTAAGG
GGATAATGGCGAGGGACTCCATAGAGTCCTCGAACACATTGGCACGCTCCACATTAAGCCTCAAATGCTCTCTCTCCGCTGGAACCAAGAGTGTTGACGT
GGCGGTAACGAAATGCGCATACTTCGAGGGGAAGTCTTTGCTTGCGAGAGCTATAGTCTCGCTCGGCGGCGGCGATGTCGTTGTGGTCTCACGTAAGCTG
CTATTTGGCGCATTTAATTCTGCGCTTCGAGGTCCAATCTCAATTTCCAGGGGCAGTTTCGAAGCGTCCACAGTGGTGTCAGAGGCTGTCGTGAGTACTG
TGTGCGTTGCTTGGGAATTGTGTACCAAGTTGGTAATGCATTCTTCCACAGATCCGAGCAATGGTTCCTGCTCTCGTATGCTGTCCGGTCCAAGCGTATT
CGCGTTCTCTGCTGCAGCCAGTTCGTGTTCTGGTTCGGGTTCGGCCGCATCCGTTCCAACAGAAGATGCCGTTTCCGTATTGTCAAAGGCAATTCGTGAT
GGTGCAGCCGGTAGCAGTGGTGAGCCATTATCTCTAAGAAGGACAGTTGATAGCTCTTCCGACACGGATTCTTTATCACCTTCACACGTCGTCGCTCCTT
GTTGAAGCAATGGCAAAGCATCAATCCCATTGGACTCACCACAAGTAGACAGGAACTTGACAACAAATCCCGTGAATCGCGTGTCCGTCCATCGTCCATC
ACGGAACCAGAACGTGCGTCCTTCAACGTCCACTTTCCTCGTCCACTCTTTGCGTCGCTGTGCCCGTAGTCGACGTCGAGTCGTTTGGTGCGTCGGCGTA
GCCGTGACCAACTGCACGCGACTCTCTCGCTTGAACAGCGGCAAGAACGATAGTCTCGGTGCCTTCTTGTCTCCGTTTTGCTGTTCGTCGTCCGCGAGCG
CCTGTCCGCACACGGTGCAGAACTTGACACGTCTGAAGTTCTCGAAGCTGCAGACTGCGCAAACGTTGAATCCCTCCTCCGCGTCTCTCAGTGCCGCGTC
CAGTCGTCGATCGTCAGAGCTGCAGCAATTGCAAAGTTAGTGTAACTGGGGCCTCAACGGAAGAGCAACGACGCACTTGAGCAGCGGCGCGTGCAGCTCC
AGCGACCGCTGGCGACGGATGTAGGCGCGTCTCGCTAACAGCGACAAGCAGCAGAAGAGCAGCGCGATGACTGCCAGCACAGCGAGGAAGCCCACCACGG
CCTGCATGTCGTCTCCGGATGAATCTGAGTGTGGCGTGCGTCAAGCATCTGCGATCGATTACCGAACTGGTAGATGCAAAAGTGTTTGTCATGGGTATAG
TTTAGATAGATTATAAGAAATGAATAAAGAGGAGAGGAGAGACTTTTGAGGAGTACTGTTGTGTCCAGGTAGCGGTACAGCAGATGAGTGTTGAGCTGCG
GGCACCGTACACCGAACGCCGACCGTGCTGATCAACAGGATGTTGCTACATGGCAGGAGCTAGGAAGGCACAGGGCAATGTATATCGCACTCACTTACTT
AATATCACTCTAGTCTGCACCCAATAAACTTCACTAATCGGTTGTAAACCCGTACACCTCGGTCTCCAGCACCGCGTACAGCACAGCCTTCAACTCGTCG
CGAACAACGTGCAGTGGCAGGTCCAAACGATTGAAACAAGCGTGGCTGTGAATGAACCCGTCACCAATCAGCGACACGGCCTTCAGTGTAAACGGGCACA
GACGACCATCGTAGCTCGTCAACGCACTGAACCCTCCGAGAGGAACGCGCGATGAACCAGTTGAAAACTGCAGCAGCCGACGACGATACTCATTTGGCAT
CTCTCGCACTAGCTCCCAGAACCACTTGAGTGAGCGGTGGTGGTGAAGGTCTTCCGAATACTTTGTGTTGCGCTCCCAGTCATCTACGTCGATCTCGTCG
GAGCCGCACAGCAGGAAGTCGAACTCTTCCGGGTCGAATAGCAGGAGAAGTTCGCGAGGGACGATTTCGTACAGGCCCTGCAAGAAGACTTGCAGTTGAG
GGGCCACACTTTCCACAAGCAGGTATTGCCACTTGAGCTCCACGAACTCGCGCTTGTTGGAATCGGTGACGGGAATGGCACTGCCGCCAGGCACGAGCTC
GATATCGCGATAGCTATCTCCATCCTTGGTAGTCACGGTGAAATCGAGATCTAGCGCATCGACATTGTCGTTCTCCAGTAACCAACGCAAATTGCTGTAC
ACCTCTGGGTCCAAGTCCTCCAAATCTTCAAAACTTAACGGGTAGCCCAGGATCAGCTTCAAAAACGGCGAGGCCAAGTGGAAGCACAGCATAGAGCCCT
CCAGGAGTGCACGTCCCAAGAGACGACCAGCCGCGAAGAGATTTAGCAGCTGGTTAGGAAGTAGTTCCATATCCGAGCAGGGGCTCATGTAGTATGTCTG
ATCACGCTTGTTAGCACAAACAAAGAGCCCACGTACTGGATCCACAAGCGCCTCATTGAGCATCACAAACCACTCACGTTGAAGACCCCCAGCGTCCACA
CCGTTCTCATCGAGGAAGTTTATGCGCACTACAGAACGAGCATTCTGGAGCGGGATGATAGCGAGGGACTCCATCGAGTCTTTGAACACGCTGGCACGCT
CAACGTTGAGCCGTAGATGCTCTCTTTCAGCTGGAACCAGTAGGGCTGAAGCAGCCATGACGAAATGTGCATACTTGGAGGGAAAATCTTTACTAGCGAG
CGCCATTGCCAGGGGTGGTGGTGATGCATTGCCTAGGACAGTATCGGTTCCCAATGCTGTACGAATTGGACTGTTCGGCAGAGTGAGAGGAAGTCTTGTG
GCATCCATATCAGCGTCAGCTGCTGATGTGAACACAGAGTGCATCTCCTGTGCGTAGTTTACCAAGCTTGCAGCGCACTCCGCAACCGATCTGACCATAG
GTCTTGGCGACATTGCTCGATTTGCCGCATATTCTTTGTTTCCCTCGGTGTGTTCTAGTTCGGGATCTGGTTCTGAGCTACTCCGGCTCGTTGAAGCATG
AGCTTCAGGTGATTTTCCGTCCACGGCAATTCGACTGTTTGCAGGCTTGAACTCAACAACAAAGCCTGTTGCAGGTGTATCAGCCCCAACATTGTGGCTG
TCACGAAACCAATATGGGCGTCCTTCGACATCAAGTTTGCGTGTCCACTCCTTGCGTCTCTGTGCCCGTACACGGCGGCGAGTGGCTTGCTTCGAGGATA
TCGAAAGTGCAGTGGACGAGGTCGTCTGCGTTCCCGTATGTCGCTTGAAAGTCGACAACATTCTCGTCAACCTTCTCCTCTCGCCCTTGTTGCGCGACGG
CGAGCGGCACGAGAAAGGTGCCTTCTCCACAATCGGCTCGCCACAAAGCGTGCAAAAGCGGACACGCTTGAAGTTCTCAAACGCACAGAAGTCGCACACG
ATGAACCCTTCCTCCGCATCTCTTCACACACAATATAGCGTCAGCTCTGCCAGCCTCCCTTTAATTGAACGGAGACAAACCTTAGTGCCGCATCCAGACG
TCGATCATCGGAGCTGCACCCAACCAAATGGACAGCAGATAGCCGTTAGATACAGCAACCACACGCAGAATACCCGGACGAAAGCAGATAGCCTCTAGCC
TCCGTTATGGTCAACTGCATGTGCACGTACTCGATGAGTGGCGTATTCAGCTCCACCTCGCGCTCGAACTTCTTGAACGAACGTCGTGCCAGCCACGCGA
AGAAGAGTGCGAAGAGCAGGGCGATCCCACACGCCACACCGATGGTCACGCCCACAGACATCACTCGGTGGCGTCCTTGAGAAGGGCGAGAAGTTGGAGA
GTGTCAGTGACACTGTGTCACGCTGGAACAGGTGCATTGCACACTTCGATCAGATGCCGATCAAAATTATGATGAAACACAGAAGTGTTCACCTTACACA
GTGAATTAGTGGGGTACAAATTGATTTGTGGTTTTACAGTAGAAGGTATCGAATCAAAGTTTTCAGACCGCGTCAGTTTGCGGTTGTGGCTGTTGTGTAC
AGTGACAGAAATCTCCAAAGCAAAATGCACTGGCGAAAAGGTCCCTTACGTGTAGCCAACGCACTATTTAACCGGTTGAAGCACGCGTGACTGTCGATGT
ACTTATCGCCCTCTCAGCGAAAATGCACACAGCCATCTATCGTAGTGCACCGCAGCCACCGAGCGGTATCCACAGGACGAACCCATTGAAAACTGCAGCA
ATCGGCGTCATACTCGTTGGGTATTCCACGCGCCAGCTCACAGAGCAGCGACGTGGTGCAACAAGTTCGAGTAGTCGTTCACGTCGAGCCACACAGCGGA
AGTCAAATTCTTCCGGGTCCAAGCAAGTCGCGAGGAATGATTTCGTACATTCCACGAAGAAGACGTGACGCTTCCTCGAGTAAGTACTGCCACTTGCGCT
CCATGTATTGTTGGACTTCGGGACGAGCTGGTCTCCTTTGTATCTACGTTCTCCAGCCGCCGACACAAATTGCGATAAACCTCGGGGTCGTAAGTCTTCC
TGATCGGCAAAGCTGAGGGGGTAGCCCAAAACCAGCTTCAGTACAGGCGATTCTAAGTGAAA