Description :
From Genome Similarity Track
Location :
Scaffold_12:321835- 323433
Transcript NameFunction/comments
Aphas_H257_06892Hypothetical protein

Sequence
1598 bases(100 bases per row)
TCCCTCGTGCACAGGTAGTGGCCTCCCATCTTTGGCGTGGGCGGCATGTATCCCAGCACAATCGTGCGGCGGGTGTCTCCGCCGCCGCGGATGCTCGGGA
TGCCGTCGACGGGTACCACGGGGTCGATGTGGAAGGCTGGGTCGTTCGTCACGAGCACAATCTCCAGATCCAGCATGGTCGCGGCGGCATAGAGTTCGGC
CACGGTAGCTTGTTCGTCGGGAACGTTCCCAAATGTCGTGTACCTAAGGGACGCTCTCGTATGAGGAAAATTCCCCTTTTCGAATCCTACTACCACCACG
TACGTACCGGTTGGTCAAGTCCTCGGACGACGTCATGAGGAATGTGCCCAGGGCGTCGATGTTGGCAAGTGCAAATGCCGCCAGGTCTGTTCGCAGCTGC
GCCGCGGCTTGCATCCGCCGCGGCGCAATCCCATCGGCAGATCCGACGTTGACCATGCTCATCGCCGCAGGATATGTCTTAAAGCAATCCCACTTCAATG
GGAACAGTTCGTACACGAGGCAATGGAGCAGACACGACCCGTCGGGCGGCATCCCCACGCCCTGCAGCCCCGCCGAACGCAGCTCCAATTCCATCTTGCC
GCGTTCGCGTTCGACTTCGGGGTCGGCTACCTCGGGCACGGTCACGGCCATCAACCTGATAAAAACGCGTTTTATATCAATCAAACACGGTCAAAGATCC
AGCGTTAAACGCTTCGATTGGTCAACTTGTCACCAACACAGGTGATCTATCCGAATGGGAATAATCCCCACATATCCCAATGAAGCGTACCTGGACGAGG
ACATGGCCGCGTCGGTCCCATCGAGCACAGCGTGCGGCGGCACCGACTGCCGTGATAAACTGGCAGCGTTGCTTTTAATGCTGTTGCTTTCGCTCGAGTT
CTGGGCAAACGTTTGACGCTCTTTGAAACTCTGGTTGAATTGCTGCGGGGCGACATGAACGAACCCGCCATTCGTGCTGTTATGGCGCATGGACAAGCAC
GCATTCCCTGTCTTCAACTGCTGACCCCCAAGGAATCCCGTGCCGGACCACCGGTAGTTGGCCGTCAAGCTCTGTGACGTCATCTGCGGTCGCGGCCTCT
CTACGAACGTGCTGTTGCGGCTGGCGCCGATCGCGTCTGCGGACGTTGGCACGTGGGTGACGTTCTGTCCAAACCCGCTCGAATACGCCACGAATGACTT
GAGCGACTGCGCTTCGATGGACGTGATGTGGAAAGTGACAAACGCCGGCGCAGACGTGACCATGCTCATGTACGTGTCGAGTTCGGCGCGCCGCGCTTCG
AGAAACGCCGCTTCCAAATGCGTCCGGAACAGCGTCCGCTGTCGATGGAGCGGCGGGAACTTGATCCCCTTCATGTGCTTGGGACTGCGCTTCCGAAGCT
GCGCGTCCAACAGCCGAAACGCCGAAAACGACCGCCACACACTCCACGTCGCGGTGCACTTGCTGCGCCTGGATTCCGAAAAGTACGTGCATTTGACGCT
CACTTCGTACTCGGCCTTCTGCAGGATGCGGACGTCGTCCACGTTGACTTCACACGTGTACGGCCGCGACGCATCGATGTCTTCGGGCCCTACTGTCA