Description :
From Genome Similarity Track
Location :
Scaffold_12:32182- 35575
Sequence
3393 bases(100 bases per row)
ACCTTGGTGTAGACAGACCAAAGACTACATACATTTACGACCACCACGACGGGTGGTCCATAGAGACTTTGGATTCCTATTGGCTGAGAGCAGCATCTCT
TAGCCAATGAGCGACATGCATAGCATTGGAATCCTGCTAACCAGCCGTTGGTAGATTCCTATCTTAGAATATTACATTTAGAGGAAGTCAGAAACATAAA
ACAAAAATAGCAGTTCTCATTTTAACCCAAAAATATTATTTGGATCGTTTATTTAGATTAATCTATACTCGGAGGCCCGAGTATAATTAACTCTAATTTA
AACTAGGATACGCTTCCTCACATACACGCGCACACGTGTAAGCTAAAGTAGTGGGCCAAAGTAGGCCCATTACACCTGGTAGCACTTTGTAGTCCGTCCA
ACGACCGACTACCTGAGTTCGTACGTCACCGCACGAACGCGGAGCTGAGAACCTTCCCATGGATACAGAGGTGCCCATGGAAAGCTCCACTATGCCTGCA
ACTCACGTTGCACGCGCTGACTGTCCCCACCTGTCGGATCCAGAGTGGGAGGCTCTCCAACGACTGTCAACAGTCATTGGTGAGGCGGCTGTAGCTACGA
TGCTGCGTACGCTAACGCCGACAGAGCAACACGGTGTTGCTCTGGGCTTCATCCTGAAGGAGCAACGCGATGTTGCTGCTACTACCGCGGTGCCGTCCGG
GACGACATCACGCGCGCAATCGCTGAAGCTCAATGTGAGTAACTATGTCGGAAGAGAGGGTGAACCCCTCCTCCGTTGGCTTGTCGAACTCGACACTGCC
ATTGCGGCTCGACGTATCGACGTATCGTCGACCCGTTGTCGAAGGTCGCGTTCGCCATTTCATGTCTTGGCGGACGTGCAAGAAGTTGGGCGTATGGACG
CCGACTCTCGGATCCTACGTGCTTTAGCACGTACGAGGGTTTCACGGAAGAGCTCAGACAAGCATTTGAGCCCCCGCAAAACGAGTTCCGGTCGAGGGCG
GAGTTCCTCGACCTGCAGCAGGGCAAGCATGATGTCCATGCTTACGCTCAGAGAGCACGGTACTTGGTCTCGAACATCGTGACCAATCCGATCGACGAGG
CGACCAAGGTCGTCACGTTCATGAAGGGACTGAGAGATTGGCCTGTGAAGACCAATCTCTTCCGTGAGTACCCGAGTACTCTCGAAGCTGCAATCACCCT
TGCAATGCAGGAGGAGTTTAGCCTGCGGCAGGCTAAGCTGCCTGCACATGTGCCGAGGCCACAGCCACGCCCGGTAGTGAGGACGGGAGGCCCCGAACCC
ATGGACCTCTCGGTGCTCGGGAGTGCACGGCCCCCGTGCACCAGCAGGGTGGCTATCGCGCCGGTGCCGGGCACCGTCGCAACCAAACAAAAAACGCTGG
ACGCCAGTAGGCGCGGGGCGCCCTACTGGTAATGCAGTTCCGCGTGTCGACCTTGGACACGCGACACTGAGGACTGCAATCCCCAGTGAGATTCATTCTC
GGTGCAAGAACCAAGATGACAAGCAAGACCTTGTCATCCTGAACGTAAACTCGATGAGAGCAAGCAGCTCTCTTCGCGCTTTGGTAGATTCTGGCGCGTC
GAAGAACTTTGTTCGACTGCGAAGTCTATCGAGGCTTGACTTCGAGGATCTAAAGATACCTCGAAGTATGTTGGAGGTACGACTGGCAACGGGTGCCGTC
GTGAAGACCCAGAAGCGCATGGTACGCGTGCGCTTCACGTATGAAGACCAAGAGTTTGTCGAGACCTTTATCGTCCTGGATCTGGACGATAAGTTTGACA
TCGTATTAGGCATGCCGCGGCTTGCACGGCATGATCCGGTCATCGATTGGGAGAAGCGCACTCTCGTGCGCTTCGGTCGCGACAGCGGAACAGTGAGCGA
TGGCCCTGTTGCCGCTACGCACGCACCGACAGGTGCGCGCGACTCCCCACTCGAGACAGCGCCTAATGCCGCTGTCCCGGAGCGCCCTGGGCGCGCGCGA
GCACGCGCGCAAGAGCAGCTAGCGTCGGCGTTGCCGCCGACAGCTAATGAAGGAAATGTGTTGATCTCGGAGGTCGACACCCGCTTTTCAGCGAATCAGG
AAGAGTCTCCGGCCTCAAGGGGCACGGATGACGCAGGCGAGTCACACGCCTCAGCCGTGGAGGCTGACGCGAATCTGATTGGATCCGTTTTGGCCAAGAA
TAAGAGCCAAGGTGACGAGGCGCCGTCGACTCCGGGAGTCGATGGCTTAGGTGAATTTGATTCGTCGGCTCCGGGAGCCGACGCACCCTCTGTAATGGGG
GTCTCCGCCAATGGTTGGCGTCGAGGTAAGGATGGCGTGTCGACTCCGGGAGTCGACGCTGCAAGCGGTGCGGACGGTTGCAAACGTCCCGCACCGGAAA
AAAACTTGCATGCTGTCGTGCACGACGAAGCGCCGGGCGACAAAGCCGGGCTTGAAGTCGCTCGCCCGCGGGATAAACCCGCCGGTGGTACTGAAGAAGA
ACACCCGTCCACGGCTGGGCCTGGGCGAGGTCAAGAACCAAGCGGAGCCGGGCTCCCCAAAACAAGAAGACGGCGCATGCGATGGTCGCTGCGCAAGTCT
CGGTCTGGGGCCGAGACGCTACAAGGAATGTCTGCCGGGCAGACGGAGGCTGAGAAGCCGGACGTCGAGACGTTGAACGTCTTGACGCGTATCTGTGCCG
GGTTCCGGTACAGGGAGATGACTCTCGCTAACCCTCCGACGCAAGCGTCGGAGTTGACTTCGCTTCCAGTAATGAACTGGAAGCGCTTCGCGCGTGACTT
GCACGATGGATGCATCGAGCAAATATGCATTCTCTCGGACGCCGAGAGAACGAAGAGCGAGAATGAAGAACTGAGGCAGTTCTTCATGGAGACCACCACT
GAGAGCGAGGACACTCTCAGTGCGAAGACGAAGAAGGAGCGCTTTGAAGAGCAGAGCTGGGACTCGTTGAAGACGAGTCCCTACTACGAGATCTTACGGG
AGTACGCGGACGTACTTCCGGAAGAGATTCCTGCGGAGCTTCCGCAGGACAAGGGAATCCAGCACGAGATTGATCTCGTGCCGGGCACGAAGTACTGTGT
CACGCGGCAGTGGCCACTGCCGCGAGAGCAGGTCGAGGCGATCGACGACTTCTTTGAGAGTCGTCGCAAAGCTGGACAAGTACGGAATCGAAATCCCCGC
ACAGTGCTCCGACGTTCTGTGTCAAGAAGCCACTGGGCGGCTGGCGCATCGTTCATCCGTACAACAAGCTGAACGATGCGACGATACCGGCGCAAGAGCG
CCCCTGCGACCTTCAACAGGTTCGTGACGCACTTGTTGCGCTCGGTGCGCGACTTCGTACCGAGCTACTTCGACGATGTGTTCGTCCACAGCC