Description :
From Genome Similarity Track
Location :
Scaffold_595:3217- 5350
Sequence
2133 bases(100 bases per row)
GGAACGCGAGGGTGGGTGAGACCGTTTACGTAGAGCGGAGTATAGCCTGTAGAGGCATGAACAGCGTTGTTCAACGCAAAATCAACAACCGGAAGGATGG
AGCTCCAACGCTTAGGCGTATCAGCGCAAACACCGCGCAAAATGTCATTAATGGCGCGATTAACACGCTCAGTTTGACCATCGGTCTGCGGATGATCCGC
TGTGGACATGTCCAAACGGGTGCCGAGCACCTTGAAGATGGACTTCCAAAATTTCCCAGTGAAGTGGGGATCTCTATCAGAGACAATTGCCACTGGCAAG
CCATGTTGTCGAAGCACATGGTCGTTAAACAGCTTCGCTGTATCTTCGGCATCAATAGAGTCCGGCACTGCCGCTAGATGAGCCATCTTGCTCAATCGGT
CGACAAAGACCACAATGCCACTGTTGCCTTCCGAATCTTTCGGTAGGCCAAACACAAAGTCCATATTCATGGACTCCCAACACCCAATGGGTACAGGCAG
ACTAGCCACTGGCGCCGCCGCATGTGCAGAGGGTTTGACCCGTTGACACGTTTCATACGTACGCACATAGGTGCTCACCCACTTGTATAGTTTGGACCAC
CAATAAGCCTGGTCCACTGAGCTATAGGTCTTCTCACGACCGAGATGACCACTTAAAGCGGTATCATGTGCCTCACAGAGGATTCGATACTTCAACTCCT
CATCATGATGGAAAGCGTTACGAGGGTTATCCTCAATATCTGTGCGATAGCACAACAAGCCATTATCGATAGAATATCGATGTAGCCTCGCACGTAAACG
TGCCAAAAATTCTATGTCCGAGTCTTAAAACTCCTCGCTCCCTAGAGCACGTAGCAAAGCTACACATTATTCATCCTTGGCATAAGCCGCACAGATTAAG
TCAGTGACTGACGATGACAGCGTAGTGACGTGAGCAAGCTCATAGTCAAGTCGGCGCGATAGCGCATCAGCCAAAGCATTTGCTTTCCTGGCTTATACTT
CACTTCGAATTTATATTCGGCAAAGAATGAAAGCCGACGAGCCATTCTATGAGAGAGATGCGGTGACTGTGTCGCAGTGCGCAAAGATGCATGATCTGTA
TAGATCACAAATGGATTTGAGCCAAGCAGATGTACTCTGAATTTGACTAGAGCGTACTTCATAGCAAGTAGCTCTTTGTCATGAACTGGATAGTTCTTTT
CAGCAGCTTTGAGCTGTCTAGATTCGAATGCAATGACGCGTTCGCGTCCATCGACATTTGTTTGTAACAGAGCACTGCCTATGCCAAAGTCAGATGCGTC
ACAGACGACACTGAAAGGCCGATCAGGATCGGTCAAAGCCAGTATTGGCGCATGAAGGAGACTTTCCTTAACTGCTTGAAAAGCCTCATGTTCGGTGTCA
CCCCAACACCAATTCACATCCTTCTTAGGGAGATTGGATAATGGCCGAGCCATATCTGCATAATTCTCACTGTAATTATGCAAGTAATTGGCAAGGCCAA
GCCACTTACGTAAATCTTTTTGGTTCTTTGGAACCGACCAATCGACTATGGCCCTTATCTTGGCGGGGTCCGCTCGAAGGCCTTGCTTCCCAATGAAGCA
CCCCAGAAAGGGAATCTCTTCTGCATCAAAGATGCACTTAGATGCATTTGCATACAATTTATTCGTGCGCATGCACTCGAGCACCGCTCGTAAATGATCA
ATGTGATTATCCACATCAGATCGACCGTTCGTTGCACAACTATGGACAAAGATGTCATCAAAGTACGTTTGTACATAGCCTTGATGAGGTATGAATAGTC
GCGTCACCAGACGATTAAAAGTAGCCGGGGCATTTAACAGCCCTTGTGGCATACCGAGCCACTCCCAGAGCATACCGCTCGGGGTACTAACCGATGTTAG
CGGAATACCGCTTGCTTGCATGAGCAGCTGGTAATAACCATCGACTAAGTCGAGCGCACTGTACAATGTACTTACCACCATATTTTTCTGAAGAACATCC
TTTCTGGGGATTGGTGTTGAGCCGGGATAGTGGCAGCATTGAGCTTATTATAAGCGTGCACAATACGCCACTTACCATTAGGCTTTTTGACACAAAAAGT
AGGTGTGGAATGGGGAGACTTACTCTCCCGCAC