Description :
From Genome Similarity Track
Location :
Scaffold_119:3217- 4914
Transcript NameFunction/comments
g9499.t1hypothetical protein

Sequence
1697 bases(100 bases per row)
GTCAGTTTGGCTACTCGGTAAGTGCATGATAGAGAAAACAGAAGCTCACCGAAGTGTCGAAGTGTAGCCTGTACATTGTAGAAAACCCACAGCACAAGTT
TTGTCTGCACTTGCTCTCCTTGTGTCTCAAGCACAAAGGCCAATTGGCGCAGTGCTGAAATGTGAAGCTTGTGCCACAGCACGAAGAAGAGTATTACCAA
TGAAACGAGCTGCAAAAAGCAGTAGAGCATCACATTCCCAAGCGTATTGCGAAGCTGCTCGTCGTCCATGTTGACGATCTGGGGGTAGTACACTCGGTTC
GGCAGGTAATACATCGCCACCAGGTTTGCCGCTAGGAAGTCAAGTCACGTAAAAAGCGTTAGATGGATTATTCAGTATGGATGCTAGAATCACCAATAAT
ACGTTCGTAAAACTTACAGAAAATGATCGGGACGATGACTTCCACGTAGTTTATCAAGACCATGAATTCAGTGATGTAGAGCACCTTCCGTACCTGAAGT
GCGTACTCAAGCTCGAGTTGCGTGACGTCTGGTTTTCCCTCTATGGAATCATTTCCCCGCACCGAGAAGACTTTTCTCATACTAAAGATTGACACCGGTT
TCGCCCGCACCAGACCACTTGGCGAATAAACAATTTGTTTAGGTACCCCCCTGCTGCTCTTTGGTTTGGTGTCAGGGTCTAGAGGGGTCACCGACCTCGT
TGTGCGAGCAGAAGTCACCTTGACTTGGGCAATCTGCGTCAGCTTGTTTCTGTTCAAAATATCTTGGGTGTACACGAGTATCGTCTTCCTTCCCAGATCA
TTTGGCTGTACAGCGGTGGGGTCGATAAACGTACGGCGAGCATGTTCAGCATCGAGCCGTGCCTTCAGAGTTTTCAAGCGCTGAATAACTATACCAACAT
CATGCATGGACGCCATCATCTGAGCGCCATCGATAGCAATTAGCCCCAGCGTTGTCCAAATCGACGGGGTGTTCTGCATGCAGTACGACATAAACAATGA
GTTGAAGACCTCAACGTTCATCGAAACCACTTCTGGGATCTCGTCGTTCAAATGCACCACCGTGCGCGAGATCACGTTGCGCAACAAAAGCTTGATGATT
GGAAGAAGACAAGCGAAAGGTGCCTTGGCATGTCTGGGGAGTGTCGTGAATATGTAGAAATACGTTGGGTAGATAAGCACAAGGATTTCCGTGCCGACCC
AAATTTTCAGCGTGTTGATCACAAGAGGCCAAACTTCCGGGTCCGATCGAGCTCGTTTCAGCCACGAAAAGAGCGGTACCAAAAGGAAAAGAACCCACGC
AGGCGAGACTGTAAGGATTCCAAACGGCAACGGGAAGCCGATAACAAGAGACGACGCGTAGAAAACACTCGTAGTTAGCGCGGCGGTGAATGCACTACTG
GCGATGACTCGTGCGTTCGGGAGCGGGGCTGTCGGGACATTGTGTCGAAACTGCAGATTAATGGTGGTACTGGCGACCCAAAATGCTATGAAAGTCCGAA
CAATGAAGAGATAGTTGGCGCGTAGCCCCTCGGACGGCGGGCGGAGAGGAATCAAGTCAGCGAGAAGTGTGATAATAACACTGGGCCACGGCATCAGGAT
CAGTACTGATAGTGCGCGAAAAGTGCTGGTGCGTTGGTTGTAGACGATGAGTTCACGAACACGCTCGACAGAGTAGGAACCATGGAGCTCTACCTGT