Description :
From Genome Similarity Track
Location :
Scaffold_24:321669- 326317
Sequence
4648 bases(100 bases per row)
GAGAAGATGTCCCCGTCTCGGCTGCGCTGCGAGCTCGCGACAAAAGCGCTAATAGGACACTGTCTCAGGCAGATTGCGAGCGAACACGCGACGCACAGCG
AGCTCGAACGAGGTGAATTAATATGACACTATCTCAGCATGATCGTCCGAGGAAGAAAGACGCTGAGCGCAAGCGTGTCCAAATGGCTAGCTGCACGGGG
AGGAGCTTCAGGAACGACGTGAGTACTACAGACATCATGTGGCGGTACATAGAGAAGGGCTGATGCAAGAGCAAAGCCAGCACGAACGCGACCTCAAACG
TGAACAACACGCACTTCGGCGTGGGCAGCTGGAGGAGCACAAAGAGAAACGGAACGTGAACTAGACCGACAACAGCAGGCCATTCGAAGAGCAGGGCGGA
CGGAAGAAGAGCGCCAGCAGGAACTCGAGTGTGTGCGCACTGGACGCCAATGCACCCGTCATGGCCATGCTCTTATTTCCCTTGAAGACTTCATTGTGTC
CATGATAACGGGTGGCGACGTGGTAATCGGCCGGCACAAGCTCCCGGTTACAGCCGTTTGCCCGATCTGCAATGCTTGGAAGTGGCCAGGCGAGTCTGCA
ATATCATGCTGCCTGGTAGGCAGGGTAAAGCTGCCTCCACTGCACCCCGGGCCAAGGAGCTGCTATAGCTGTACTGAGATCCCGAGTTTCGCCGTCAAAT
CCGTGCCTACAACCAAGCCTTTGCGTTTACGTCGATTGGTGCTTCGTGCTCAAACCGATCGTTTCACAACGTACGTCAGGACGAGAGCGTTGCCGGTACA
CACGGGGTGTACACGTATCGCATACAAGGGGCTATGAGACACTACCTAGGGTCTCTCCTCCCCCACGTAGACCGTTGGACAGGCGCACGGGTAGCTTCAA
AGAGTTTGCGCAGATCTACATTGTGGATCCAGACATGCAACACCGCGCGGGGCGGCGTCTTGGTATATTCGCGGATCTGGATCGTGTTGCACTACTAGAC
ATCGAGAAAATGATGGCAGAGCACAACCCATTAGCGCAACGGTTCCTCCACTTTGGGCAGCAAGTGCGTCAACACAACACGATGGGTTCCAGTAGACTTG
GTGTTCCGTCTGCATGACAGCTCCTCACGACCGCGGACTCATAACCGCCCCACTGTGCTTAAGTGGCTGCGACTCTCATTGAGGATGGCAACCTGGCTCA
GCCTTGGGATCTACTACTCTTTACACGCGATCAAATACTACTACGTTTGTACGAGACTCACGCCGATTACGATCCACTCCAATACCCGCTTCTCCTTCCA
TCTGAAAAGAAGGGCTGGACCTACACAGACGGTTTCGCGAATGGTGCTGAGTATGAAAATAAAAAAGGCGATGTCGCTTCGTGAACACGTAGCGTTCCGC
CTTCATCAGAAAGTGGATGATCAGTCCGCTCTCCACCAAGGCGGGCGTCTATTTTAACAGCGGTGTGTAGATCGGCGTGCAAAATGTGAGCAAGAGCCGC
TTCGCTGGGAGGCCGACAATCAGAAAACACTTCGCGCCCATCAATACAGGGGTGTGCAAGACGCTTTACTCAATGAAGATACTTTGGCTCTGGCGGAAGG
AGAAGTGCTGCTGTTGGAATATGACCGGGTCCAGAACAGATTGGTGCACCCGGACCGGGACGGAAGCAGGAGGGGGCGACCTACCCTTTCTTAATCAGGT
TGGCAAGCGTATCATACTACCGACTTCGCACCTGGGTAGCCCGCGGTCCATGTACAAGTCGTATCAAGATTCGATGGCAATTGTTCGGGAGTATGGACAG
CCCGACGTCTTCCCCACTGAAACTTGCAACCTTGAGTGGGACGAGATTTTTGAAGCGATAGCTTCCGAAATCCAGACAGATCAAAATCGACCCGATATCG
TGGCTCGCGTGTGGCAGCAGAAACTGCAAGCGAGGCTTGGCGATTTAAACCAAGGCGTCTTGGGGAGAGTGCGCGCGCAGATTTACGCTGTCGAGTTTCA
AAACGAGGGCTCCTTCACGCTCACGTATTGGTTATTTTGGCTGACGAAGGCAAACCTCGAACGCGCGAGATCGTACACAAGATGGTATGCGCTGAGATCC
TAGATAAGGATAAAATCCCTCAGCGGTATAAGACGGTCATGTCATGCATGCTCCATGGTCGATGTGGACCTGCAAACCCTTCCTGCGCATGTATGAAGGA
CGGCAAGTGCACCAAAGGGTTTCCGAAGCCCTTGGCAGAAGTCACACAAGCCAATGTCGATGGATATTCAGTGTACAGACGACGTCGACGGCAAGAAGGT
GTTCTAATGTTCAAAGGCAGAGAATACGACAGTGCCACGATCAACCAGTGAATTGTACCGTACAACCCGTACTTATCCCAGAAGTACAGCTGCAACATCA
ATATGGAAGTGTGCACGGATGTAACTGCGATTAAATACCTGTACAAGTATGTGTACAAAGGACCCGGCATGGCTATACTCACTGTGGCAGAAGTCCCAGG
AGGGCAGGAGAGTGCGCGTCGAGAACCAAATACGATTCTACGTTTCTTGAGCGCCCGTTACATTTTTCTCCGGTGGAGGCTTGCATGCGCCTGTTCGATT
TCACGGCTCAGGGGAAAACTCATGCGGTGACACAGCTTACGGTTCATCTCGAGTCAGGCCAGACGATTTGCTTTCGCGAGACGGAAAACCCGGAGGCAGT
TTTGGAACGTAATAGTCACACGATGCTGACCATATTCCTTGCCTTGTCTGCGAGTGAAGAGCCTCAGAACTATATTGCTATAACGATGTTGTATCAGGAC
ATCCTCAAAGAGTTCTGTTGGAAAGCGCCGGAGAAAGGGCAAACGAAAAGGTGGGTTCGCCGGAAACAGTATCAGGCTGCGCTTGGTCGCATGATTCACG
TGTCTCCTCGAGATATTGAGCGGTTTTATCTTCGGCTACTGCTCTGTCAGCGTAGAGGCCCAACGTCGTTTGAAGACTTGATAACGGTAAACGGAATTGT
CTGCCCGACATTCCAAATTGCGGCGCGGGAGGCTGGCTACTTGGAGAATGACAGTGAGAGGATTTCCTGTTTGAGGGAAGCTGCTGAGCTCCAAATGCCG
TATCAACTACGCCAGCTCTTTGTCACCATTCTGATGTATTCAGCTCCAGCAAATGCTGGTGCTCTATGGAATCGGTTCTTCGCTGACCTTTCCCAAGATT
ATGCACGGAAACATTAGACTTTGATGGAGCCCTTCGAATCGGCGATGGTAGAATTTAAAACGCTGGTGAGCATCAAGAACTACTTCAAGTGAGCGGGTAT
GCAGTAGCTGACTTCGACGAACTTTCTCAGTTGGGGTCGTTCCCAACATTGATTCGTGAAGCGCTTCGCCAAAACGGATTACTACGACGTGAGCTCACTG
GATACGATGCGTCGGCTTTGGAGGCAATTGTAAGCACAGAAGATCAGCTAAACGAAAGTCAGCGGGTGGTTTACGACCAGATTATTGAAGCGGTTGAATG
CCCGGAGGAAGGCAAGAAGTTATTTTTTGTCGATGGCCCGGGTGGTACTGGAAAATCTACACTGCTTCGAAACATACTGGCCAAAGTCAGAATCTCGGGG
AAAATCGCCATCGCTGTGGCGTCTAGCGGTATTGCCTAGCTCTTGCTCATGGGTGGTAGGACAGCTCATTCTAAATTCAAGATCCCTTTGAAATTGAACG
AGAGCTCGACGTGCGGTATCAGGAAGAACTCCAATATTCAGGGGTTGATCAAGCATGCAAGCTTGATTATTTGGGACGAAGCACTTATGGTCCATCGCCA
CGCATTCGAGGCAGTAGACAGAACACGGCGGGACATACTTGACAACGATACCGAGCCTTTTGGAAGGAAAGTGTTTGTACTTTCGGGAGATTTCCGCCAG
ATTCTCCCGGTCGTGAAGAATGGAACACCCGTCTAGACAATTGACGCTTGCCTCAAGTCGTCTAGACTGTGGCCCCCATTCTAGACGTTCTGGCTTACGG
AAATCATGCGAGTGCGCACAGCTGAGACTGCGGACACTGCCGAGGAAATGGCTGGGTTCTCCGAGCTCTTGCTTTAAGTCGGGGAGGGAAGGCATGATGT
AAACCATTCCCTAGAGAGCGATTGAAGATTCCACGCGATATGCTGATTGAAAATCCACCCATGCCCGAGGATGAGGACCAGGAAATTCGTCCTGATGTTA
TTCCAAGAGGCATGGATCGGATCATCGACGAGATGTATGGAGAGATTAACAACCCCGAGGTTACTACCGACGAGTATTTTGCTAACCGTACGATCCTCAC
GACTACGAACGCAATAAAGCACCACATCAATGAAGCGGTGGCCGATCAACTTACTGGACAGGCGCGGGAATAAATGTCTTCCGATTCTGTACAAGACGAC
GGTGACGGTAATTTCTTCGAGCAGGTGGTACGCCAATTGATGAATATCAGTGGAATACCTGACCCTCAAGAAAGGAATGCCTATCATGATAATGCGGAAC
CTGAATCCAGATCTAGGGCTGTGCAACGGAACACGGCTTCGAATCGTGGCGCTCAAGCCACATGTCATCCACGCCACAATCATGACAGGTGAGCGACAAG
GGCAACATGTGTTGATCCCCGCACTGTTTTTTATCAGTGACGGAGACA