Description :
From Genome Similarity Track
Location :
Scaffold_336:32166- 33169
Transcript NameFunction/comments
g17517.t1ABG66536.1 reverse transcriptase, partial [Phytophthora ramorum

Sequence
1003 bases(100 bases per row)
GTGGACTTCTACGAGATGCACCACGGGAAGCATGAGGACCGAGCAACGGAGTCCGATGATCGGTGGACTAGAGCGAGGACGGCGTTCGATCTACTGAAGG
CCAAGCTTGCGACCACCCCGATTTTGCGACACTTCGATTCCGATCGCCAGCCTGTGATCGTGGTATACGCCAACAAGTGGGCTATCTCAGCTGCGTTGGT
TCAGGAACATGATGGCATGTATTGGCCTGTGATCTTCACCAGTCGTACGCTGAAGTCGAACGAGTTGAATTACGGCATAGTGGACAAGGAAGTTTTGGAG
CTCCTCCGGATCTTGGACGTGTGTTACACACTCCTGACCAACCGATCGATCAAGGCGCTGTCGAGGTATTCGACGCTCGCCTGGTTGCTGAATGCGTCGG
GCTTCCAGGGACGATTGGGACGATGGGCAGCTCTGCTGTCCGAGTGGACCTTGGAGATCCGGAAGTGCTTGAAAGGAGAGGACGAAATCCTGGGCGCGAT
CGCCGCCAGCATTACACCCCGAGCGGAAGTGGACGAGGCCTTGATCGCGATTGCACCAGTGAAAGAGCCCAGACGAACGATCGTGATGGCCCCGCCGACG
GTAGAGCTGGATGAAGAGTTGCTCGTCGTCAGTTTTGATGGGTCAGCACGCGTCAAGCGGAGCGCCGGAGCGTATAGTGCAATTGTCTGGAAGCTCCCGG
AGTGGTCGATCACATCTGCCGTCCGAATTCGCCGACGACCTGACTGTCAACGAAGCCGAATATCGCGGACTTCTGCTAGGCTTCAAGCTACTGTCCGATC
AGAACAGGGAGCGAGTTGTGATCTGCGGAGATTCCAATCTGATCATCCGACAGATGCGTGGTGAAATCGATTGCAAGGCACCGGGTCTCCAGATACTACG
TCAGAAAGCGATGGATCAAGTGAAAGCCTGGCCGAAGCACGAATTCCTCCATGTGAAGCGCGATTGGAATCAGAGCGCCGATCGGTTGGCAAGTGCGGCA
CTG