Description :
From Genome Similarity Track
Location :
Scaffold_7:3216- 6410
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G003504Similar to USP15: Ubiquitin carboxyl-terminal hydrolase 15 (Homo sapiens)

Sequence
3194 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNGGCACCGAGAATAGCAGTGGTATCAACATCTTGTCTCCGCAAAGTCGCGCGTTCCTGGCGCGGTTGCCTTCCTTTTCGTCACGTACGCGAGA
AAACGACGGCGGCACTTCGACCGCGAGTCCTGAGACGTCCATGAGTGCCGCTGCAGCTACAAGCCTGCGCTTCCAAGTACGCGATAGCGATGGCCGGCCC
GACGCCGAGGTCGCGCGCGAGTGGTGGATCACGCACCTTCTCAATGAGCCATCGATCTGCTCGGCGCTATTTTGCGGCCAGTTCAAGAGCGTGCTCATGT
GCGACGTGTGCGGCGCGACGTCGGCACGGTTCGAGTCCTTTGCCTCGCTCCAGCTCCCGCTTGTTGGTTGTACAGACCGAGAAAAAACTTCAGATCAAGA
TGACGATGCTGCACAACAGCAAACGATCGCAGTCGTCGTGCTCTTGCACGCTGCAAAGCCATCGAAGAATGGCGTACCGTGCATTTTGCGGCTCGTGGTG
CGTGCAGGGATGGACTGGACGCTCGAGCAGCTCTTTCTGAGGTTACAGCGATGCGACGATCACTCAGTGTCCCGTTCAAAGGACCATCATCCTCACAAGT
TCATCGCTGGTGTGATCGATGGTTGCTGCATCCGCGAGTACGTTGACCACGACACGCTGCTGGCGACGATCCCGTCGACCATCGACGTCTTTGAACTTGG
ACGCGAGGCTGGTGACCCGCAACAGGATAACGACCCTACGACTCAGCCAATGGATCGCGTGTTCCATGCCGGCGACGAGCTCTTGGTCTGGACAGCTGAC
GATCGACTCGTGACATCCATTGTGATGATGGTGCATGATCCGCCTTCGCCTCGTTCAAAGTGGGGGCTAGAGCAATCGCAGGACTCGCTGTCACCTGTGC
CTACGGCTCGATATGACGTGGTGCTGAACGAAGGTCTCCGACGTGGAGTCACCATGCGGCACGTTGCGTGCGTGCGGCCAGTAGGCACCAAGCGCACCCT
AGTCATTCGTATCATCCATCGCCGCGAAGTGCTCGTGCCGTTTTACTGCACGTCGCCACATCGACTTGCACTATGCGGGTCTCCAACGATCCATTGCGTG
CAATCAACGTTGGCAACGGGGAAATCTCTGTACCGATTCGTGCAGCAACGCTTTCTGAGAGTGCCGTCAGTACGAACATCGCCCGTGTTTGTGCTACGAC
GCGTGCGCAGCGATGGGAAATGTTGCGCACGCTGCCACTGGACAACGAGATGCGTCGGGTGCCTCGTCCCACGGACCAATGTCCTGCTCGAGGATCTCGA
GATGGACGAAACCATCGCAATCGATTGGTCCGTTGACTCTGATCTAGGTGACGAAGACGACAGTGAGGGTGACGAACCGTTGAGATGGTTGTTTACGTCT
GGCAGGATGCCCATCAGGGACGACGAGAGCTACGTGCAGTATCGGCAGACTCACTCGCAGTGCCTGATACGAAGTCTCGAGGTCCTGTGCGATTCAGAAA
AGATCGACGCCACATGCACGCGTTGCCAGCAGCAGCACAGCAAACCTTTGGGTGATTTGCGCCCCATAGAAGGAGACCAAAACGCTCTGGTACAGCACAA
GAACGCGCTGTCGCCTCATACAAAGCAGCTCTCGTTCTGGAGCGTCCCCCCCATCCTGATCGTGCAGCTCAAGCGATTCAAGCTGGGGCCCGGGTATGTG
TGGGGAAAACTGCACCACTGCGTCGATTTCCCCATCGAGTGTCTCGATCTCGCGCCGTTTATTTCTGAAAGCGCATTACAGGACTGCAATGCAACTGCAA
GCGAACCAGTGCAGCGCGCGGCCGCTTTTCTACAACAGGAGCTTCAATTCCCCCTCGAGACGGCGTCGCGAGCGTGCACGGGGTACAGTGTGTACGCGAT
TGTTAACCACATGGGCGGGATCGGATCGGGTCACTACACGGCGCACATCAAACACCCAGAAAGCGGAGAGTGGTGGCTCGTCGACGACGCAAGTACTGCA
CCCGTGACGGTAGAGACACTCACGCCATCGGCAGCGGCGTATCTGCTGTTTTACGTGCGCCACGACATTGTGTCTCCGCCGTCACGAGCCGACGAGAGCG
CCGCTGCGGATAGCTCAAAAGTAGGAAATAGTGGCTCTATACTGCACGAGCAGATGCGGTTGTCCTCACTCTATCCTCGCAAGAGCCACACGTCACGTTT
GAGTGAGGCAACGATCCATGAAATGTGGCAACACGAGACGTGGACCCACGCATCCGCATCAAGCGGTCAATTCACAAAGGACAAGTGCGAAAAC