Description :
From Genome Similarity Track
Location :
Scaffold_1935:3216- 5415
Sequence
2199 bases(100 bases per row)
GGCGTCGACGACATGGCGACGCTCAATCACCTGCACGAGCCGGCGCTGCTGCGCAACCTCGAACTGCGCTTTGCCAAGCAGATGCCGTACACCTACACTG
GCCAGATCTGTGTCGCTGTGAACCCGTACCAGTGGCTAGACCTCTACGGAACGGTACGTCGAACGCTGTCGTTTTGATGCGTCAAGGTGAAACAACACGC
AGTTGCTAACTAACTCTCGATTCACACGTCGTCATTTGCGCCACAGGACCTCTACGACCAGTACCTGGAGCTCCCCCGCGAGACCCTCGACCCGCACCCG
TTCGCGCTCTCGGCCACGTCGTATACCGACATGAAGCGCACTCAGATGGACCAGAGCATCCTCGTGAGTGGCGAGTCCGGCGCCGGAAAGACCGAGACGG
TCAAGATCATGATGAACCACCTCGCGTCGATCTCGGGCGGCGGCGACCGCGGCGCCATCGTCATCAACCAGGTGCTCAAATCCAACCCCCTCCTGGAATC
CTTCGGTAACGCCAAGACCAAGCGTAACGACAACAGTAGTCGATTCGGCAAATTCGCGCAGCTGCAGTTCGACTCGGTGGGCTCCCTCGTCGGCGCGCGC
CTCGAGACGTACTTGCTCGAGAAGAGCCGCGTGGTCGGCCAGACGTACACGGAGCGCAACTACCACATCTTCTACCAGATCTTCCGCCTCGCCGAGAGCC
GAAAGAACGAGCTGCGTCTCGAGGGCACCGCCTCTAGCTACAAGTACGTGCGTGCTGGCGCCGACGCGGAGATCGCTGGCGTCGACGACGTCCAGTGCTT
GAAGGAGACCCAAGAGGCCATGGACGTCATTGGTATCACCATCGAGGAGCAGAACGGTATTTTCGAGATCGTCTCTGCGATCCTGAACTTGGGTGAAGCG
AACTTTGTGCAGGGAGTCTCTGAAGAGAAGAGCCACGTCCAGAACGAGGAGATTGTGCAAAACGTGGCGCACCTCGTGCAAACCGACGTTGAGGCCCTGC
GCAGCGTCTTGCTTGAACGCTCCATCACGGCTGGTACCGAGTCGTACACGATCCCGCTCAACAGCGAGCAAGCCACTGACCTCCGCGACGCGCTCGCCAA
GGGCATATACACGCAGCTCTTCGACTGGCTGGTGCACCGAGTCAACAAGGCGATCTGCTCGACTCGCAACGTGAAGACGCACATCGGTTTGCTGGATATC
TTCGGTTTCGAGTCGTTCGAGACGAACGGCTTCGAGCAGCTTTGCATCAACTACGCGAACGAGAAACTCCAGCAGAAGTTCAACAGCGACGTGTTCAAGG
TGGTGCAGCAGGAGTACATTGAGGAAGAGATCCCTCTGACGCTGGTGACCTTCGAAGACAACCAACCGATCTTGGACCTGATCGAAGGCCGCATGGGCAT
TGTGAGTCTTCTGAACGAAGAAGTGCTTCGTCCTCAGGCCAGCGACATCACGTTCGTGAGCAAGGTGGTGGATGCATTCGGCGACCACCCGAACATCGAG
AAGAGCAAGTTCAACCAGATGCTGTTCACGATCCGTCACTACGCCGGCGATGTCGCGTACAACGGAACGGGCTTTCTCGAAAAGAACAAAGATACGCTCC
CGAGTGACATGGCGCAACTTCTCCAGGGCAGTTCGAGCAAAGTGATTGCTGACATTTTCACGCCACAAGAGGCGATCACGGAGCGCAAGTCCGGACCGGC
GGCGCGCACCAGCCGAGGTAAGCAAGGCCGTCAGCAGAAGGGTTTCCTGGTCGGCAACACGATCGCTGGTGGCTTCCGCAAGCAGTTGGGTGAGCTGATG
GAGACCATCAACAAGACGGCATCCCAGTACGTCCGATGTATCAAGCCAAACGCGAACAAGAGCCCCGAAGAGTTCGATCGCATGATGATTGTCGAGCAGC
TTCGTTGCGCCGGTGTGATTGCTGCCATTCGTATCAGTCGTGCTGCGTTCCCGAACCGACTTCCTTTGGCGGACTTCCAGTCGCGCTTCCAAATTATTTG
CCCCTCGTCGCTGCGTGATGCGTCACCTGCGGACATGGTCGTGGGTTTGCTCAAAGAGCTCCTGCCAGAGGCGGCTGCGAGCACTAAGAACAGCAAGTTT
GCTGTGGGCAAGACCAAGGTGTACTTCAGCTCGGGTTTGCTGCAGAAGCTGGAGGACCGCCGAAATGCGATCCTGAAGAACCACGCCATCATCATCCAG