Description :
From Genome Similarity Track
Location :
Scaffold_1110:3216- 4699
Transcript NameFunction/comments
Pytir_DAOMBR486snap-pir_contig_1110-abinit-gene-0.14ATP-binding Cassette (ABC) Superfamily

Sequence
1483 bases(100 bases per row)
TCCCGCCGACCATGATCGCGGCTTTGTTGCAGAGCGCCTCGCACTCCTCCATCGAATGGGTCGTGAGCATCACCGTTGTCTTCCTCGAGCGGACAGACAC
CTGGAGGATCACGTCCCACATGAACCGTCTCGCGTGCGGGTCCATCCCGGTGGACGGTTCGTCGAGAAAGAGCAGATCCGGTGCTCCGAGCATCGCGATC
GCGACCGAGAGCTTCCGTTTGTTACCACCACTCAGGCTTCCCGCGAGTTTGCGCTCAAACGCCTTGAGCTGGAGTTTGAGGAGCAAACGGTCGACCTCTT
TGCTTAGCAAGAGCGAGCCAAAGCCCTTCATGCGTCCATAGAACTCCAAGTGCTCACGCACAGTGAGCAGCTCCAGGAGCGCGTCAAACTGCGGACAATA
GCCAACACATCCTCTCATCTTTGAGCGCTGCGTGAGGATGTCGAGTCCATTGAGCTTTGCAGACCCAGAAGACGGCAGGATGTCGCCTGTGAGGATCTTC
ATCGTCGTGGTCTTTCCTGCGCCGTTGATGCCCAGAAAGCCAAAGCACTCGCCGCGGGCGAGTCCGAAAGAGAGGTTCGAGACCGCTTTCTTGCCGTTCG
GGTACGTCTTTTGGAGGTTGAGAAGCTGGACGACTTCTTCTTGCTCGTCTAAGGTTGTACGAGCTGGTTTGGATATGTTCGCTTGGAGGGCCCGTCGAGC
TTCGTTCGCAACATCTTCGTCTTCAGGACACACCTCGACAGACTCTTCTTGCACGTAAAGCTTTGCATTCCCTTGGCAGCGCCAATACTGAAACAAATGA
CGAACCCAGTTGACAAGCAAGAATGGTCCTCCTGGACTTCCCTTTGAGAGAAAGCTGACTTCGCCCGTCTGGATCCAGTCGATGATAAGCGCCAACAGAA
AGAAAATCGGACCTTCGGCAGCGAGGTACGTAATCTCATTGCCCGCAATCTCTGGATCGAAAGCGCTATTTGCTACTGTCGAGAGTCCGTAGAGCACTTC
GATGTCCGCGACAATCACGCGCAAGAGCCCATTTCCGAGCGAAAACAGCGGCGAGCAGCGCCAGAGGAAGATCAGCGCTTGGTTCGCTGCTTGCGTAGAG
GTGAGCGAGTCGAGCGACACGCTCATGATCATGAGCAACAGTCCCAAAAAGAAGTTGAGCATGACTGTGTACAGCAAACACGCCCCCGGGTCCTTCATGA
GGTGTGACATCAGGTACGTCCATGGAGCGATGGCCCCGCCAAAGAGAAAGAACAGGCTCAGCACTGCCTCGGGAACATCGCGCGTGCAACCCTTGCAGCT
TGCAGTTGAGCTGTTGCTGTTGAGCGACGAGGTGATTCCGTACCCTCTCAGCAGCAGGATGGCGACCGTCATGGGAACCAGGTACAGCACATAGTCAAAT
ACAAAGTTGGCGAGCCAGTAGGCAGCGAGCGAGACGCCCGAAAGTATCTGCTGGTGCTTGGCGTTCTGCTCGTTCTGCTTCTC