Description :
From Genome Similarity Track
Location :
contig_4:321534- 322846
Transcript NameFunction/comments
g1262.t1RAW31555.1 hypothetical protein PC110_g12092 [Phytophthora cactorum

Sequence
1312 bases(100 bases per row)
AGACACTGTACGATCAAACGCGAAGACCTCGTCAACGTTCGACTTCATGTTAACGTCGACTTGGTAGAGGCGTTCGGGCCTCTCCGGTGCCAGGCAATGC
AACTATCCAGCACAAGACATAATGACGGTAAGCTTGCAACTCAAACACCAACACGCAGAACAACGAAAAGTAACGTACCCGGACACCGCGGTCATACATG
CAGTCTACGAACGTGATGAATCGCCGCATCTGGTTGAGTCGCTCGGCGTTGAGCAGAGGAATATCGTTCACAAACACAACCGAGAAGGCCTTGGAGATAG
CCAAGTAGTCTGCCGCACCGAGCGGTTTATCGCACAGGTCACGGAAGGAAAAGCGACACGCGCCCGCTTTCACTGCAGCCTCCGGTACATGCACTTGACG
CCCTTGCGTCGTCACGTAGGTCTCCACCGTCTCCTCTCCGCGACAGTAAGTCATGAACTCGTAGTCGAACGCAGCACGGGTATCGGGCGTGATCGGATAC
TCGTACACATTGTCAGCATGCACCGCGCCCTTCAACACGCGGTAGTCCGTGGTCGAGTCTTCCAGCGACACGACGTTGCATCGTTCTCCTAGTAGGTCGA
TGAACGGCACGAACAGTTCTCGCTGCAGCCCGTTCTTGTAGAGCTCACTTGGTGGTCTATTGGACGTGGCGACCATCACAAAGCCTCGCGCCAGCAGGGC
CGAGAAGAGCCGCCTCAAGATGAGCGCGTCCGCCACGTCCGTCACCTGGAACTCGTCGAAGCACAGCAGCCAGCTGTCCTGCAGCAGCTTGTCGGCGATG
TGTGGGATGGGATCCTCTCGGAAGCCCTGCTGACGCAGCTCGTGCATCTGCTTGTGGACGTCCAGCATGAACTCGTGGAAGTGGACGCGCTGCTTGTGCT
CCACTGGCACATTGTCGAAGAACATGTCCATCACGAACGTCTTACCGCAGCCCACGCCGCCGTACAGGTACAGCCCCTTGGGTGCAGCTTCCTGTGCAGT
TTCCTCATCCTTTCCAGTCAATTTCTGCCACCACGAGCCACTAGACGCCGCCTTGGCCTTGGGGCCGCCATAGCCCACGAGCGAGTCGTACAGTGCGTCC
AGGTGGTGCACGGCGCGCACCTGCACGGGGTCGTACGTCACGTCGCCGTCGTCCGCGCGCTGCTTGTAGACGCCGTGCAACGTGTGTTGGCTGGGCGGGA
TGGACGTAGCCAGCGTCGAGTTCCAGCGTGTTGGCTGGCGCAACGAGGCCACACGGCGAGCAGTTAGTCGCAGCATCTTCCAAAGGCCGAGACGTCTGGC
TCCGCTGGCAAA