Description :
From Genome Similarity Track
Location :
contig_4:321512- 322833
Transcript NameFunction/comments
g1364.t1ETL78431.1 hypothetical protein L917_20771 [Phytophthora parasitica

Sequence
1321 bases(100 bases per row)
GTCACGCACCTCCGTCAAGCGAGACACTGTACGATCAAACGCGAAGACCTCGTCAACGTTCGACTTCATGTTAACGTCGACTTGGTAGAGGCGTTCGGGC
CTCTCCGGTGCCAGGCAATGCAACTATCCAGCACAAGACATAATGACGGTAAGCTTGCAACTCAAACACCAACACGCAGAACAACGAAAAGTAACGTACC
CGGACACCGCGGTCATACATGCAGTCTACGAACGTGATGAATCGCCGCATCTGGTTGAGTCGTTCAGCGTTGAGCAAAGAATATCGTTCACAAACACAAC
CGAGAAGGCCTTGGAGATAGCCAAGTAGTCTGCCGCGCCGAGCGGTTTATCGCACAGGTCACGGAAGGAAAAGCGACACGCGCCCGCTTTCACTGCAGCC
TCCGGTACATGCACTTGACGCCCTTGCGTCGTCACGTAGGTCTCCACCGTCTCCTCTCCGCGACAGTAAGTCATGAACTCGTAGTCGAACGCAGCACGGG
TATCGGGCGTGATCGGATACTCGTACACATTGTCAGCATGCACCGCGCCCTTCAACACGCGGTAGTCCGTGGTCGAGTCTTCCAGCGACACGACATTGCA
TCGTTCTCCTAGTAGGCCGATGAACGGCACGAACAGTTCTCGCTGCAGCCCGTTCTTGTAGAGCTCACTTGGTGGTCTATTGGACGTGGCGACCATCACA
AAGCCTCGCGCCAGCAGGGCCGAGAAGAGCCGCCTCAAGATGAGCGCGTCCGCCACGTCCGTCACCTGGAACTCGTCGAAGCACAGCAGCCAGCTGTCCT
GCAGCAGCTTGTCGGCGATGTGTGGGATGGGATCCTCTCGGAAGCCCTGCTGACGCAGCTCGTGCATCTGCTTGTGGACGTCCAGCATGAACTCGTGGAA
GTGGACGCGCTGCTTGTGCTCCACTGGCACATTGTCGAAGAACATGTCCATCACGAACGTCTTACCGCAGCCCACGCCGCCGTACAGGTACAGCCCCTTG
GGTGCAGCTTCCTGCGCAGGTTCCTCATCCTTTCCAGTCAATTTCTGCCACCACGAGCCACTAGACGCCGCCTTGGCCTTGGGGCCGCCATAGCCCACGA
GCGAGTCGTACAGTGCGTCCAGGTGGTGCACGGCGCGCACCTGCACGGGGTCGTACGTCACGTCGCCGTCGTCCGCGCGCTGCTTGTAGACGCCGTGCAA
CGTGTGTTGGCTGGGCGGGATGGACGTAGCCAGCGTCGAGTTCCAGCGTGTTGGCTGGCGCAACGAGGCCACACGGCGAGCAGTTAGTCGCAGCATCTTC
CAAAGGCCGAGACGTCTGGCT