Description :
From Genome Similarity Track
Location :
Scaffold_1796:3215- 5513
Transcript NameFunction/comments
Phyag_g11496hypothetical protein PHYSODRAFT_247331

Sequence
2298 bases(100 bases per row)
GTTGATGGCAAACTCAGCATTCGCGAGATGTAAATCCCAGTCATCTTGCAGTTGCCCAACGTAGCTGCGTAGGTATTCTTCGAGTGTGCGATTCATTCGC
TCTGTCTGTCCGTCGCCTTGGGCACGGTGTGCTACGGTCATGCTCAACCTCGTTCCAACTGATTTGAAGATGTGTTGCCAAAAGGCGGCAACGAATTTCC
TATCTCGATCTGATACGATGCTTGTAGGCATTCCATGTAACTTCCAGATGTGATCGACAAAAAGTTGTGCTACACCTTCTGCCGTCACAGTTTTCGTGGT
GGGCACGAAGTGGCAACGTTTCGTGAGGCGATCGACGACAACCCAAATGGAATTGACTTCGCGCTTTGTCTGCGGTAAATCTGTGATGAAGTCCATCGAG
ATTGACCGCCAGCGTTCATCCGGGATGCTCAAGGGTTCGAGCAAGCCGGGAGGTTTTGTCAACCTCGGTTTATTCCGCCGACATGGTTCACAGTCCGCAA
TGAATTTCTGGgtcgacttcaacatcttgGGCCAGTACCAATGGCGCACTAGCGTCAAGTACGTCCTCTCAGCCCCTGGATGTCCTCCATAGTTCGCGTC
GTGGCATTCTCCAATGATTTTTTGCCTCAACTTCACATCGTTGGGCACAACAATTTGGGGATTGTCATCTGCTGGGGATTGGTACCATAACAAGCCGTGT
GCTTCGTAATAGCATCGGTACAACTTCCGATGCTGTTTACACTCTTTGGGTTTCAGAGTTGTGGAGCGCAGCTTGATCGCGGCAAAGATTGTCCTTGCCT
CTCGATCCTTGTTGTACGCCTTTTTGATCTTCGAGATGATGTCCGAGCTCATGACCACATCGCTTATCACCAAGCTAAATGATGTGTCGTTGAAACTGGT
AACGCTCAAGTCGTGGAGAAACTTGGTCTCTGGTTGCAGATCGGGCCTTCTACTCAGTGCGTCTGCAATTCCATTCTTCGCACCCGGGAGGTACGAGAAC
GTCGGTTGATACTCTGCGAGGATATCGTACCACCGCGCTAAACGACGATTCGCCATCTTCTGAGTGAATAAACCCTCAAGACTTTTATGATCTGTCTCGA
CGACTGGCGGTCTCTCCAAACAGTATATCCGACAGGCTGTAAGCGCATTGACGATTGCTAAgagttcctgttgctgtgttGGGTAGTTGAGCTCCGCGGG
TTTCATCTTGCGACTGGTGTATGCAATAGGGCGTTCAACCCCGTTGATGACTTGGAACAGGactccaccgacagcgaaCTTACTAGCGTCTGTACGAAGA
TGCATTGGTTGACTGAAATCTGGCAGGTGCAACACTGGTGGGTTGCACAACCGTCGCTTCAACTCTTTAAAGTTCTTCAGCAGTTCGTCATTGAAGTGAA
CTTTCGCGTTGcgtttgttcttcttcttcagcaggGTAAACATCGATGCTGTTAGCGAGGCGTATTCCGGGCAGAACCGCTGGACGTATCCAGTTAGACC
AAGAAAGCTGTGCAGCTCCTCTTGTGTCCGTGGCACTGGCCAATCTTTGATTGTCTGCACCTTATCGGGATCCATACGCACTCCGTTTCGCCCAACAAAG
TCTCCTAGGCATGGAATCTCTTCGGCACAGAAGACACACTTGGAAAGCTTAACGTAAAGCTTGTTCTCACGCAGAATGTCTAATGTCTCGCGTAGTGCAT
CCAGGTGATCTTCGATTCTTGGTGACTTTGTGAAGATGTAGATATCGTCATAGAACGACTTCGTGTTCTTCAAGTCTCGGAAGATTTTCGACGTGAGTCT
GTGCATTGTTGCAGGCGCGTTGCAGACTCCCATTGGTAGCACTAGGTACTCCCAGAGACCGTTTGGAGCCTGGAAGGCAGTAAACTTAATGTCTTCCTCA
CGCATGCGTACCTGATAATACGCGGACATCAAATCCATTGTGGATAACCAGTACGATCCTGCCATCGCATCCAAGATGTCCTCCTTCCGCGTCATTGGGA
TGCTTTGTCGCACTGTGTTGGAGTTTAAATACCGGTAGTCACGGACTATCCTCCAGCCGACTGGTTTCCGAACACAGAACGTCGGCGCGGCGTGTGGACT
GATGCTTGGTCGGAtgagtttcttcttcaccatgtCGACGACCCATCGTACAAtttcgcgttgctgctctggagATTGTCACCACTGCCGCCGGTACATC
GCGAGATTTGGATCCTTCACACCGATCCGGTGCTCAATCTCACGTTTCTCCGGTAAGCCTTCAGGTAGTTCTGGGCGGAACACGTTATCCTTGTACTC