Description :
From Genome Similarity Track
Location :
Scaffold_888:3214- 5081
Transcript NameFunction/comments
Phyag_g8559putative malonyl-CoA decarboxylase

Sequence
1867 bases(100 bases per row)
TAGATTTCGTGCCGCAGGTGGTGATCCAGAGTCTGTGTAGCACGTACCGAGGCATGAacatcgacgagaagaagcaattTCTACTCATTTTGGCGCAAGA
TCTGCATATTGACACGAATTTGGTGGGGATTGAGACGGAGGGAGCTTGTGGCATTGACTGCTGCGGACTGACTGGTGTTTTTGGCTGCTTGCTCCTGACG
ATGAGTAGGCTCTGCAGAGTGCTGTCCAGTTTGAACAAAATGTAGCTAATGTGAAGGGTTCTCGCACTGGGTTAATTGAATGGGAGCGCGAGAACGTGGA
GAGGTACTTGCGCACATTCCGAAATCTTCGCAACGCGTTGTCACCACTTTATGAGGTAATGAACATCAATCATTGATTGGAAAGTATCGAGGAGCTGACA
CTGATGGTATTTGTTGCATAATGAGGCAGACCTTCTTCCAGCAAATCTTGTCGCAGCGCGAAAACGGCATGTTGTTCTTGGTGCACATGCGAGCGGATCT
ACTGCAAGTTTTGCGCAAAAGAGCGATCCATGCCGAAATCCCTGCTCTTCGCTCCCTTGACGGAAGCTTAAAGGTGCGCTTCAGGCTTGCGTCCATTCCT
CACCCGAGACTAATGCTGTGCTCGTTGTATGCACTTGGTATCTTACGTTGCTGCATAGCAATTTCTGGCGTCATGGTTTAGTGTTGGCTTCCTGAAGCTA
GAGCGTGTGACCTACGAACACTCTCCTGGCCAACTTTTGGAGAAAATCATTCGCTACGAGGCGGTGCACCCAGTGGGGACGATCGCCGAGCTAAAGAGAC
GACTTGGTATGTTTGGAGTAAGTTTGCTTTGGTGCTATTGTAACAGACTGACTGATGGATGCATTATGTTGCTATTGTTTTCAGGCAACGGACGTCGTTG
CTTTGCGTTTTTTCATCCGAGGTAAGACATTCATCTCCAAAGCTATTGAAAGCCAAGCCTGATACCATGACTTCTCTTTGGTGTAGTATTCCGGACGAAC
CCTTAGTATTTGTGCATGTAGCACTGATGCAAGATATCGCCTCCAGCATGCAGTCCATTCGTGACGAAACGGAGCAATTGACAGAAGCCTCTCAAGCGAA
AGCTGCAATTTTCTATTCCATCTCTTCAACGCAAAAAGGACTTTCGGTAATTATAAGCCTTGCATGTACACTGGACATCGTCGAGCTAATTAACCGCATC
TGTTGTTGGTTGCAGGGTGTGGACTTGGGCAACTTTCTCATTAAAGAAGTCGCCAAATCTCTCAAGACAGAGTACCCGCATTTGAAAACATTTGCGACTC
TGAGCCCTTTACCACAATTTCTGCCATGGCTCGAAACGCAGCGGTGCAAGACTGATGAGTCATTAGTATCCCCGCTTGAGCTGGACGTCCTGATCGATGT
ACTGGGCGAACGCGGGGCCCCCATTCAATTGGACGCAACTCCAGTCGCCATTGTTTTAGATGCGCTAGAAATCGACGATTGGAACGAGGATTCGGATCTG
GTCGCAGCACTAAAGCCTATCATGCTGAAGCTCGGCGCACGCTACATCTACCACGAAAAGAAGCGTGGAAAGGCTTTAGACCCTGTAGCCAACTTCCACG
TCCGAAATGGCGCAATTTTCGAGAGAATCAACTGGATGGCGGACCTATCTAAGAAGGTGCGTACCTGTGAACGCACTGTGTATAACGCCTTATCATTGAA
TTTGTTGGCTATCGTTGTGTTTTAGGGTCTTGCGCAAAGTGCTGGGATGATGATCAACTACAAGTATGATTTGGCGCATGTGGAAGCAAACAACGAGAAC
TACTTGTTGCACAACATTATCCCCATCGGACTTCAGCCGCAGCAAGTCCTTTAGCTGCGCGCGTTTG