Description :
From Genome Similarity Track
Location :
Scaffold_9:321383- 323487
Sequence
2104 bases(100 bases per row)
TACATGCGTAAAGTGTCACCGGCATTCGGCCCTGCAGATGGAGGAACACGACTAGCTGTTATAGGCGCCAACATCTTACCGGAGATGGACATAAAGTGCT
TGTTCGATGGTTCAACGGAAGTTGCACCTCTTGCATTTATGCTCGGAACCGTAGAGTGCATTACACCCCCAATGCAAATCGGATCACACACGGTGGAGCT
CATTACAGACGGCGCCAACCGAATCTCGAGCAACTTCGTGCAGTTCGGCGCTGTGGCTCGTGAGCAAGTATTCCAAATCGACCCGTCTCGCGGCATTCAA
ACCGAAACTACTGAAAGAAGAATACGTATCGTTGGCGAAAACTTCATGGACTCGGCAAACTTAACGTGCACGTTCGGTGAGGTTGAATCACCTGGGACGG
ATTTCATTTCGTCATCTGAAATCGAGTGCGTAGTTCCCTTTACCAGGCTGGGAAAGAAGCATGTCCGTGTTTCCAACAATGGTGTCGATTTCGCGGAATC
AAAAATGATGTATGAGGTGCTACCGAGAATGTCGATCGCTACTATTTCACCTCGCCACGGATCATTTCTGGGTGGAACTGTTGTTACTCTGACTGGAGTC
TTTGGCAAACATGTGGGGATCGAGTGTCTTTTTGGCGAAAGAAGCGTCGATGCTCGCCTTGTTAATATGTCGAGTATTGAGTGCACTGCACCTCCCGGAG
CAATGAATGAGACTGTGTTGGTCGGTGCGCGCGTTTACAACACGCTTGCCCACGTCGAAGAAAATGCTGACATGTACTTTGTGTACGGAGATGGCCCCAT
TGTAACCGATATTTCACCTCCCGTTATTTCGCGGTCTCTGATACGGACAAATGTGTCCGTGATTGGATCAGGATTGAACGTAACGGAGTTGGTGGGCTGC
CAATTTTCACAGCAGCCTACTTCTCGTTTGTATCGCAATCAGGGCAGCGTATGGTGCGAGTTTGATGCTCATGTAACTGGTGTATACAACTTGACGTTTA
TCTTAGAGAACAGCACTCTCAAAAGCATCCCAACACACCAAAAGATTCACGTCATTCCAGCTATTCAGCCCATGGATATATCCCCGTTACAGTTTGACGA
GAGAGGTGGTGCAGGAGCTGTTATATCTGCGCTTAACATCACTAGCACATCAAGGTCTGTTCGATGTCTGTTTGGGAACACTACGGTTACGGCGTTGGTC
CTGTCAGATTTAAAACTGCACTGCATAACGCCACCCATGCCTCCCGGTCATGTATCCCTCCGATTGAGTCAAGATGATTTTTCTTGGTCTGAGCAATCAC
TTGATGTTGTAGTGTATGCAACGCCAATGCTGTTTGAAGCTTATCCGAACCGTTCCGTTGCGATTGGTGGTAATACTATCGTGGTGTCTGGAACAAACTT
CAAGCCTTTCCATAATGCAAGCTGTCTGTTTGGAGAGACGAAAACTCTAGCTATCAGCGTGAATGAATCAATACTGAAGTGCATCACTCCCAATGATATC
ACGTCGGGTGTTATATCGCTTGGAGTTAGCTTAAACGGCATCGAAACAAGTGGCAACAGGCTGGATGTGGAATTTTATGACTTACCCAGTGAACTAAAGA
TTCGATCGGTGAAGCAATCGCAGGATGGTCAATGGACTGCAATCGTTCAAGGAGTCAATATTACTGAAGACGCCAACTACGAGTGCCGCTTTGACGGCGT
GCCCGGGTCGGGAATGGTTCTAAACGTAACGGATCGTGGCATGGAATGCGTATCCGACGCACAATTTGAACAAAACCGCCCAAATTTGTTGACGATTTCT
CTAAATGGAGAGGCATTACTCCACCAAGACATTTTCAGAAATACGGGATGTCCAAGTGCTGTTAACGGATTGTCGACAACCGTGTTGCGACCTGGACAAA
GTCGTTCCATTACGCTGTCAGGCTATCGGTTTGACCCTTCAATGACGCTAGCCTGTCATATCGGCCCAGTAACCATCCCTGGTTTTGCGAGGTCTGAAAA
CACAATGGCATGCCAACTTCCTACTAAGAAACCTGGAAACTACACTGTTCAAGTTACGTGCGCAGCAGGGTCGGAGATCCTCGGCATTTTTCCAATTGAA
TACG