Description :
From Genome Similarity Track
Location :
contig_38:321373- 322774
Transcript NameFunction/comments
g8378.t1hypothetical protein

Sequence
1401 bases(100 bases per row)
ATGCTGTACGCTCGCCTATTAGCAGCGTCGGCTCTGGCGAACGCTCTCCTGTTCCGCAAGTCAACTCGGAGGACTACACGGTCAAGGCCGATCCCGCTAC
GACACTTATCAGTACCTGGGAAGGATGGGGCACATCGCTCTGCTGGTGGGCCAACGCCTTCGGAGACCGTGAAGACATCGCTGACCTACTCTTCACCATG
AAGGATACCGTGACGCTCGACGGTGCGTCATCTGGTCTCCCAGCGCTAGGCTTCAACATCGCGCGCTACAATATCGGTGGGTCTGGCAAAAACGTCATCG
ACGACAGCGGCACCGAGATCGCGATGAAGGAGTCCAAGAACATGCCAGCCTTCAAGTTCATCGAATCGTTTTGGCTCGATTGGTCGAGCAACGACACAGC
CAGCAAAAGCTGGAATTGGGAAGCTGACGCTAAGCAGCGCAAAATGCTCGACTTGGCGACTCAGCGTGACGTTGACATCACGGAGGCGTTCTCAAACTCG
CCACCATGGTGGATGAACAGCAACCATGCGACTGCGGGCGGGGACAGCGGAACAAAAGATAACTTGCAATCCTGGAATCATGGACAATTCGCGCTGTACC
TGGCTACCGTAGTGAAACAGGCCAAGGAAAGCTGGGGAATCAACTTCACGTACGTTGTGCCGTTCAACGAGCCTATGAGTACGTGGTGGCAGTATCCAGG
TGGCCAGGAAGGCTGCCATTTTGAGGTGGACACCCAGAAGATGTCGTATTGAAACTGCGCTCTAAGCTGGACTACTTTGGGCTGCAGGACGTAGCCATTT
CCTCATCCGATGAAAACTCGGACACGCAGGCACTATCGACGCTCACTTCCATGTCGACGGACGCAGATGTGATGACTGCCATCGGAAAAATTAACACACA
CGGCTATGGTAACCGCGAGTCGGATCGGGCACCACTGAAGAAACTCGTGGAGCAGGTAAAGAAGAAGTTTTGGGACTCCGAGTACGGCGAGAAGGACGCG
ACGGGACTCAGCTTGGCTGAGGCTGTTGCGATTAACATCAACCAAATGGGCGTGTCGGCGTTCGTCTACTGGCAGCCGTTTGACGGCGGGGGCTGGGGCC
TCATCAATTCTGCTCCGGGTAATTTGACGATCGACACGCCCAACCCCAAGTACTATGCGTTTGCTCAGTACTCGCGCCACATTCGACCCGGCATGGCGAT
CCTTTCTTCGGATGACACGAACACCGTCATGGCCTACGATACCGCGTCCAAACTCCTTGTACTTGCAACAGTGAACTCAGGCGACACGGTTTCGAAGGTC
ACTTTTGACTTGGCGAGCTTTTCGAAAGTGACAGGGCCGATTAGTGCGTGGACGACGGAAACGAGCGGCACGGGTGCGCTTTACAAGTCCTCGAAGGTCG
A