Description :
From Genome Similarity Track
Location :
contig_38:321369- 322770
Transcript NameFunction/comments
g8762.t1RAW25280.1 Endo-beta-1,6-galactanase [Phytophthora cactorum

Sequence
1401 bases(100 bases per row)
ATGCTGTACACTCGCCTATTAGCAGCGTCGGCTCTGGCGAACGCTCTCCTGTTCCGCAAGTCAACTCGGAGGACTACACGGTCAAGGCCGATCCCGCTAC
GACACTTATCAGTACCTGGGAAGGATGGGGCACATCGCTCTGCTGGTGGGCCAACGCCTTCGGAGACCGTGAAGACATCGCTGACCTACTCTTCACCATG
AAGGATACCGTGACGCTCGACGGTGCGTCATCTGGTCTCCCAGCGCTAGGCTTCAACATCGCGCGCTACAATATCGGTGGGTCTGGCAAAAACGTCATCG
ACGACAGCGGCACCGAGATCGCGATGAAGGAGTCCAAGAACATGCCAGCCTTCAAGTTCATCGAATCGTTTTGGCTCGATTGGTTGAGCAATGACACAGC
CAGCAAAAGCTGGAATTGGGAAGCTGACGCTAAGCAGCGCAAAATGCTCGACTTGGCGACTCAGCGTGACGTTGACATCACGGAGGCGTTCTCAAACTCG
CCACCATGGTGGATGAACAGCAACCACGCGACTGCGGGCGGGGACAGCGGAACAAAAGATAACTTGCAATCCTGGAATCATGGACAATTCGCGCTGTACC
TGGCTACCGTAGTGAAACAGGCCAAGGAAAGCTGGGGAATCAACTTCACGTACGTTGTGCCGTTCAACGAGCCTATGAGTACGTGGTGGCAGTATCCAGG
TGGCCAGGAAGGCTGCCATTTTGAGGTGGACACCCAGAAGATGTCGTATTGAAACTGCGCTCTAAGCTGGACTACTTTGGACTGCAGGACGTAGCCATTT
CCTCATCCGATGAAAACTCGGACACGCAGGCACTATCGACGCTCACTTCCATGTCGACGGACGCAGATGTGATGACTGCCATCGGAAAAATTAACACACA
CGGCTATGGTAACCGCGAGTCGGATCGGGCACCACTGAAGAAACTCGTGGAGCAGGTAAAGAAGAAGTTTTGGGACTCCGAGTACGGCGAGAAGGACGCG
ACGGGACTCAGCTTGGCTGAGGCTGTTGCGATTAACATCAACCAAATGGGCGTGTCGGCGTTCGTCTACTGGCAGCCGTTTGACGGCGGGGGCTGGGGCC
TCATCAATTCTGCTCCGGGTAATTTGACGATCGACACGCCCAACCCCAAGTACTATGCGTTTGCTCAGTACTCGCGCCACATTCGACCCGGCATGGCGAT
CCTTTCTTCGGATGACACGAACACCGTCATGGCCTACGATACCGCGTCCAAACTCCTTGTACTTGCAACAGTGAACTCAGGCGACACGGTTTCGAAGGTC
ACTTTTGACTTGGCGAGCTTTTCGAAAGTGACAGGGCCGATTAGTGCGTGGACGACGGAAACGAGCGGCACGGGTGCGCTTTACAAGTCCTCGAAGGTCG
A