Description :
From Genome Similarity Track
Location :
contig_15:32134- 35037
Transcript NameFunction/comments
g3964.t1hypothetical protein

Sequence
2903 bases(100 bases per row)
GTCCCACTGAGTGAAGGTCATACCGGTATCCTACCGGTATACGACAGCTGCCCGAGGCGCCTTCTTGACAATATGTACCCATGTCTATTGAGGGTATGGA
GGGTATGGAGGGTTACCGGTTTGGTATCGGTTGTTTACCGTGAACCGGTTAACCCGAACCGGTCCAATCCGAACCCACGCCGATTACGCCACCGACGATT
ACGCCACTGTCGATTACGCCACCTGTGGGTACAAGATTGTAGGTACAAGATGGGCTTCGACGTGGCGCTCTCTCATTGGCTGAAGTAACTCAGTATCCAG
TAAAGAATCAAGTAGTGTGTATCCAGTAGGTCTAGAGTAGCGAGAAGGCTAGCGAGCTAAAGACCTCAATCAATCACTTTCGAATCTTCGTTCTACCCCT
CAAGTGGTTTCCAGTCTCCGCTCCGGTCTCGCCCAGAGTGCTGCCCTCCCTCCGCTCCGTCAAGCTTCACGGTGTCCAAGATCCATACCTTCCATCAGGT
TATGAGCCCAAGCACCATGTCCTCTGCCCACGACGCCTCCACCAAGGTCTCCATCGACAAGTTCAACGGAGACAACTACGCGACGTGGAACCGCTACATG
CGTGGCGTGTTCCTGACCAAGTCGGTGTGGCATGTCGTGAACCGAGAGACGACGCCGAGCTTCACGGACTCGCGGCCCAAGGACGAGTACGTCAAGTCGA
GCAACATCGCGTTCGGACTGATGTTGCTCCACATGGACGCGGACTACCACCATGTGGTCGACGACTGCGAGGAAGCGTGGGTTGCGTGGACGCGCCTGAA
GACGCTGTACGGTGGTTCGCAGAAGGCTGGTCGCATCTACCTGAAGCGCCAACTCTTCAGCATGGAGATGTCGGAAGGCGGGAATGTGACGAAGTCGATG
AAACTTTCTCGCCCAAGTGTATAGCGGTAGCCTAGACTTAGTCCTGAAACTTAAGCCTGGGGGGTGTAAACCCTGAACGCGGTTCCTTGAAACCGTGATT
CAGAGTGGCATGGCACCTTGTGTAATCCCTATCGGCGTCGATTGCTTCGGGGGAAGCCCGGATATATCACTACAATGAGTTGTCAAATACAAATAGGCCT
TGAAAATGCTGAGCGTAACGTCCACTTCCTGAACGCACTTCTCCAATGTCTGGAACCGGTATCGAGAACTCGGAACAAACACCACTTTCAGATACCCAAT
ACAAATACAGAGTTATATACAACACGCAGCCGTTACTTATTCTTATAGACCCTTGAACGGTGGGTCTGAACACCAGTCAACTAAGGCTGAATCCAGGATA
CTGGTCAATCCTGAAGCCTTTTCTTCACACGCGCACCACCCTCAGATGAGGGAAATAATACACACCAATACAATCCTATCTCAAACGCAGTCTATCAAAT
ATTCCTGGGGATGACTGCTACTATCACCCAAGAAGGCCTTGTTAATATGAAATGAAAACCCCGCCCTTACCGTACGCGCAGCGGGTCCAACTAATATAGG
GAATGCAAGGATCACGTCAAATACTTACGTGAATGATCCCCTCGCAACTGGGCTTGAATCTTGTAGAGAGCCCCGCACCGAACTGCCCTTAACTGAACGG
CGGACCCGTGTCCTGCTTGTCAGAAGCTCACTTACTTTGAGCGACTTGCGTAGTAGGGGGTTAAACGAACTCTGATTGTTATCTTTGCTAGCCATCGCTA
GCTTCTTCGTAAAGGGTATCTGTCTGTCTTCGTTCTTCTGTTTCTTCTGTGTTCTTCCGTGTTCTTCAGTGTTCTTCTGTGTTCTTCTGTGTTCTTCCTG
GCGACCTTCTGACTTTGACTTGGCTTGAGTATACTGGCTGTCACTTCGTGGGTTCACTTTCCATCTTCAAGGAGTCAAATCCTCGCATTGGGTTCTGGGT
GTCTGAACGTGGGTTCTTCAAACCTACTTTCAAGTTACTTGACCTTGAACATCATTTTCAGGTTCCAATTTCTTGAACGTAGATACTTCAGACTCACGCT
CAGGGTTCTTCAACTTGGACATTTAGCTGAAACCAGTGTGTACGACCTCACAGTACAGGATAGTCTTGAGCACGTATAATACATGCGTTCAGACATCCGC
GTTCAGACATCTGCGTTCAGACATCTGCGTTCAGACATCCGCGTTCAGACATCTGATGTGATCAAGGTCTCATGACCAAATCATACTTCATTGTGAGTGT
CCACACGGCATTTCTTCAACGGGCTTTTTGTTTGTCTGGCGTCTGGTGACTTACGGTGCACTCCGGGTACACGGACATTCACACGCTCAGGCTTTAGGCA
AGGCGGGACACCATATGTGATACATTCACATAGGCATTTTCAACTCCATTGGGTTAACCCGCTTAAGGACGGGGTTGATTCAGACATAGATCCAGTTTCA
GGCTGTTTGGAGCCTAATCTGACCTTCCAAATCTGGGGGGCCCATCTTAAAGCCTGAGCGCATCCGCTCCGCGGAACACAGCCGAATTCCACATTCAACA
TGCGCAATGCGCATAACCAGTACTCAAAATTTTCAGTAGCCAATCAAATATCAGCACATATCCACGTCACTAGTCACCCATTGATTCCAACCGAGAAATT
GCACTCAGTCTCGTGTCAACCGTCCCTTCCGGTCATGGTCTGTCAAAGAGGAACTTTCCGAGGAGAGGCACCATGTCTGGAACTGATAGGAGCAGGCTTG
AGCCTGAACGTGGTTTTACCGTTGCTCGGCAACTTGCGCGGGCTCAGCACCTTTCTCACCCTTTCGCTCCGGGTCTGCTTTTCAGCATTGTTAATTCTGG
ACTCCATTTCTTTTAAGTCACACTCACTTCAAAAATAGCGTCTGAGTCACAACTGCCCCAGAGTCATCCGTTCTTCAATTCCGGTTTCAGGTTTCTCTCA
CTT