Description :
From Genome Similarity Track
Location :
Scaffold_33:321338- 327048
Transcript NameFunction/comments
Phyci_65225Hypothetical protein
Phyci_221951Hypothetical protein
Phyci_308593Hypothetical protein

Sequence
5710 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCACTGCTAAGCCTGACGAAGGGATGGATGCCTCAGCTGCGG
GGGTATCCTTCGCAACACCTTTTGCATTAGATTTAGTAGCCTTCATATCCTTTGCAGCTGATGGCCCAGGAAGCACCAACTGTGTAAGGGAGTCCCTTAA
CGCTATGTTCCTTAAAGGGACATAGCGTTGAATGCACTTGCTGGGAAAATGATGTCGGTGCTCCCATTCAAAACGCCACGGATGTAGTTCATCACGTATG
TTGACCGAGTGTAGACAGACACCCGCCTTCGCTCCACACTTTCCTCCCCAACTCACAAGGCCCACTACCACATTATTGGCCAGGAGTGGGCCGCCAGAAT
CGCCATTGCATGAATCCCTACCTTCACCGCTTCCAGCACACATCATTTCCTGCGTGATACGATTGCCATATTCCTTGTTGCATTCTGGGTTTGATATGAT
TACCACGATCACTTCCTGAAGTGTAAAGCTTCCCACGCGATCTTCCGTCAGCCCCACCCGAGGACCGTGGCCACTGTACCAACCTTATTGTCGGAACCAT
TACGTGCACACAGTGGTGCTACCTTCTGAGTCGAGGGATTCTTGACTCAAGACTCAAGACTCTTGAGCTTCAGCAACCCGACGTCGTACAAGTGTTTCCC
GTTATTGTACAAGGGGTGACGAAATCTCATAGCCACTTTAACCAACTCGCTGCAACCAGAACCTGCGCCCGATCCAAACTCTGATCCGAGAGAAGCGTAT
ATTTGTCCCTTGTCTGTCTTGATGCAGTGTCCAGCCGTGAGAATGTCTGCAGCGCAATCAGCGTGCCACCACAGAAGGTTTTCCCGTGAGGATCGAAGCG
CAGACTTGCGATGAATGGATATTGGTGTACGTCCTCTTCCGAACCACTGTAAATTCGGTTCTCTTCATTTGTGGGTAGACCCGTGTCGGCGTTTGGCTCG
GAATCGAAACTGGACGGTCTCGGCGTACGCATGTCACCGGAGAACTCGTAGCCGCATGTTACCCTCGATAGAATCATCAATGTCGAGACGCAGGCTCCGA
TCCGCGAAAACTCCATGCTTTCGCGAGTCAAGGCAAGAGCTTTGTTTCGGTTAGCCTAGGAATGAGCTTGTGCGTGAAGAAGGAAAATCAAAGTGGCGGA
AACTCAAGAGTACAGTAGTGGATAATCGTAGTCACGGGACTCTATAGCACCATCCCGAGGATAAATTCGCTAAAGAACAAGATAAAGAATAGTTGTGGCA
CGGCAGTAGTGTCAGCGACAGAAACTTGGCACGATGGATCCGCTACCTTTGCTCGAGGAAACGGCGAGACACAAACATTTTGTCTGTCGTCGGAAATTGC
TGAGGCGCCAGGCTGATCAAATGGTCGAGCCATCGCGGAAGTTTGTATCCACCCGTCGAGCTTGGCTGCAATGATCCGGAGGTACCAAGGTAGTGGTGAG
GTTGGCAAACAAGGCCAAGCTAGAGTTGTCGGAATTTTTTGCCAGAGGTGTCGATGACCTGAGTAGGTCTGCATGAGTCTGCTAGAGAGTTGATACATTA
CTTGTTTGTTGAAAGGAGGCGTAAGGCTCTGACTAAAGGTTGTCGTAGCGCTCTTCTCCAAGCTAAAGGCGACGGCAGCACCGTGAAACCATTGCGAGCA
GTAAGTTTTGGCAACGAAGCAGTTTTGTGCATATAGCATACGATGTTATTCCAACGCAAAATTGTTTAGCTTAAGTGTCTACGCAGACTGTTGTTGCAGG
ACCGCGGCGGAGCCTGAGTCGGTAGTCGGCGCAACAGTGGTTTTCGAAGCCTTAGTAGCGGGAGTCTTCTGCTCCGCCGAGGATCCGTCAAACGAAAAAG
TTAGTCCTGTCGTTGAGGGGCTCTTCTGAGCCGCCGTAGAGCCTGTAGATGCATCGGTACTCGAGGTCTTGGTAGTTTTAGCAGCAGAAGCCTTCGTGGC
CGAGTTCTTGACAGCAGAAGTCTTTCCGGCCGGACCAAATTTTTTGCCGTCTCCACCGGCAACAATGTCATTGATGTAATCCAGCACGGACGACACGCGA
GTGTACACACCAGGTTCCTTGCCGCACTTTTCACCAGCCCAGCTCACGAAGCCCACGAGAGCGTCATCGGCAATGAGAGGGCCACCCGCATCACCACGGC
ACGAGCCCTTGCCTTTGCCGTTGCCAGCGCACATCATGCCTTCCGTCAGTTGGTTCTTGTATGAGCTGTACTTGCCGCAGTCCGCGTTCGAGATGATAGG
AAGGTCCGCCTGCTGAAGTGTGAAGCTGTTGGAGCTTTCCTCAGTCTGGCCCCAACCGAGAACGGTGGCCATCGTACCGACCTCCTCGTCCGATCCGTCC
GCGGCAGGCAAAGCCGCGATCTTCTGCATGGACGGCTTCTCCAGCTTGAACAAGCCCACGTCGTACAGGTGCTTCTTTTTGTTGTAGAGGGGGTGCTTGA
AACCCTTGACGATCTTCACCAGCTCGCCATCCTCCCCAAAGCTGTACTCGGTGTCGAACGACGCAGTCATGGCAACCTCGTCCGTCTTGATGCAGTGAGC
CGTCGTGACGAGGTACTGCGGGGCGATCAGCGTGGCAGCACAGACTGTCACGCCATGAATGCGGACACTCGCCACGTACGGGTAGTTGTCGATGTCAGCG
TCGGCGCCACCGAAAATGCGGTTCTCCTCGTCCGCAGTCAAGCCGGTACTCTCCTTCTTAGGTGTTTCCTTTGCTGCAGCTTTCTTGGTGCCCACGAAGT
CGGAAAACGAGTAGCCGTTCGCGGATGCCGACAGCGTCGCCAACGTCGAGACGAACGCACACACCTGTAAGAGCTTCATTGCCCAGAGACCTCGTTTAGC
TACGGTTTTTCGAACAGTGCGAGGAGAAAAGATGAAGTGACCCCTGCAGTTGGAAAGCAACCTGTCGATGCACGTTAGCGCGGTAAGGTGTTCAAATCTT
GGGATATTTGTGTTGTGGTGCTAGCAGAGCGAGAGTGTTGTCGAAACGCCATCGCGCCACCATCCAGCGCAGCTGGAAAACAGCGGGATAAGTTCATGAT
GGGAAGTACTGAACCACGACAATTTTCGGCAACATCATTGATGTTCGACCTCAATGCGAGGTGCTGAAGTTAATCTGTACAAGCGAGTCTATTTACTGTT
TACTTTAAAGTAAGAAGCTGGTCAAAAAGGCACATATTCGTGTAACTTGGTTCCTACACATTGAAAACAAACTGAGCGCGAGACTCATTTTTTGTNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCGCACGACCGCTGTTTTCGTAGCATTGGGCTGGG
CAGCTACAGTTGGTGGGGTAACAGACTGCTGCCCCATACCTCAATTCAGTTGCTGGCACCATTCGTCCTTATGCTCGAATCACATCGCTCTATGCGGCTA
GCACCACCGATGCTCCGTGGTATTTCGTGTGCGAATGGAGCTGACTTCTACACCGGATAGCGAGCGCGTCGAGATGGTGGTGGAGAGCGTCCAGCATAAC
CATAGTCGCCCTTGTACGATATTAACACACAACAACAACAACAACAAAAGTCTCTACAAACAATTCTAGAGATCTTGTGCAATTGTCATTTTACAATGAG
AGAGCACAGTGACAAAAACTAACCCAACCTCAAATTGCTCACTGTACattccacatagactagcccaatgatgtccacttcactgaacatgaagtcacaa
gtgaattgtaatatttcatggattagtgacagttgtacaaccAGACAGCCTTACAGGTACACAACCACAGTCATGGCGCCACCACATCTTTTGACCCACA
AACATACTCG