Description :
From Genome Similarity Track
Location :
Scaffold_30:321274- 337854
Transcript NameFunction/comments
Physo_134177hypothetical protein
Physo_134178hypothetical protein
Physo_134179hypothetical protein
Physo_134180chromodomain helicase hrp1, putative
Physo_134181hypothetical protein

Sequence
16580 bases(100 bases per row)
TCCGATCCCTGACCGTTAGATGTGGAAGTTCCGTTGCTAAGCCCAACGTGCCGGCGGGCGAGTGTATCTTCATTTTGTTGCCGTGCAGCGAATCGCTCCG
CAGCACGCGCCATTCGCCCTCCACCGGTAGCCGGAACAGCGGGGATTGATGTTGTAACTCCAGCGATGGCCCCACTATGAATGATGGCACTGAATTGCGC
ACCCAAAGACTGATTCGAGTTGGCACCAGCAGAACTCAGCGAGATAGCGAGTTGGACAATGCGTGGATCGCCAGCGTCCACATCAGGTGCAGGCAGGCGC
TTCAGCAGATTTTCAGCACGTTTCTTTAGGCGTTCGCCCTTTAGAGCTCGTTGCCCTTGGAAGTGAAGCAAATCATCATTCAAGATGTCTTCCCAACCCC
CAAATCCATGGACGTAAACACCAAGAAGCAACGCTGCATCCTTGCGCTGAGACCAGTCATGTTCCTTTTCAGCCCAAGTCCAGCTCGGCAAGTCCCGGGT
CTGAACTCCCAACACGGAGAGATCGCTCTGCTTCGCCACCAATACATATGCCCCTTGAGCATTAGCCTGTGCATTTCCTGAAGAGCAACCAGCAGTCCGC
AATGCGCGTTGAACAGCGACCCGGAGTTTGAGGTTCTCGTATAGGCGTTCAATAATCTGTGACGATCGAGCCTCCACTTCAGCGATCTTGATGTTATCGT
GCGGTGGTCGTGCCTCGACGGCACGCTTGGCTTTCTGAGCGACATCATTCGCGAGAGTCTGCAGCCGATCCATGGAGACCTTGGTAGTCGCTTGCAGATT
TGACCGCTCGATAAAGCTAGGCATCTTGTACTCGTCTGCGAAATTCGCGGCTTTCGGATAGAGACCTACATCGGTCAGGTCTCCGTAGCGAAGCATTGCA
CGAAGCATCGCGCGAACCACTTTTCCGTCGACTGCAGGAGCTGACGACTTGCTCACGCTGCTGCTATATCCATCGCCCCCCGCATCCCCTCCATGATCAC
TGCTGCTACTATTTCCTGTAGCGATTCCCCCTGAACTTGTCGCAGTCATGGGCTTCGTAACAGTTTTGTTGGTCATTACCGAAACCGGCGGTACCGTGGT
GCTTCCAGCAGTCGAGCTGGCGGGCTTCTTCGCCTTGGCGCTGGTGGTCCTGCGTCCATTAAGTTTCATCGCCAATCTGTCATGTGCCGACACTGGTTTC
CTCTTCACTGGCAGTCGTCCCACTGCTCCGAACTGACCCAGCGGACCACCCACAGCCATCGGAGCGCCGCTGTTCACCACAGCTTCGGCTTCTGGAGACC
TCACCGGCGATCCTTTCGGCGGAGGAGGACTGGACCTCGCAGCGGGGGCGCCCAGCGGCTTCTTCCTCTTATCACGTAAGTCTCTTTGGATTTCCTCGAT
GGTACGTCGATCGCGCTTGCGGGTGCCCAGCGGCATCATCGCCTCTGTCTCTGAGGCTTTAAATCTCGCCGCCGCTCGCGTCGAGTTCACGTTCAGACTC
TCCGTAGTCGCAGCGAGGCCATGAGGGCGAGGCGCAGACAGTGCCGGGCCCGTATTGTTGGAGGGGTAGCCATGGCCAGTGCGGCTGGCGATGCCTCCTC
CGTGAGGAGTGGCGTGCTTGGAGCCGCTGGCGTCTGCGCCGGCGTTGGCGTTCTCTGTCTCAGCCTCGTCCTCCGACTCCGAGTCAGAGGAGGAAGACGA
GGACGAGGATCCCGAGCTGGAGGAGGATGAGTCGTCGTCGGAGCTCGAGTTATCGGCCTTGTCCTCCTCTTCGTCGTGGATGTGCGTCTCCTCCGGGTTC
TCGGCCATTATGGGGCTTTATTCGCTGGGAAAAGCTGTCAAAGCAAGATGAGAAGAAGGGCAACCACGTCGCGGTGGGAGAACAGAAGCAGGTCGCGCAA
CGACGAAGCTACAGCGCCGGGAAGTGGGAGGAGCGATACCTGCTCGGGCGTCTTGCGGGTGACGGAGAGCGAGTATTTCTGAGCTCGTCACTGGCTGCCG
AAACGGCAGTGCCGTTTCATTGGTAGAAAGTGACCTGCATATTGACGAATGGTGGGATTAACTGAAGATCTGGCGATTGGATTGGTCCGAATGTGAAGCC
ATTGCTTTTTGGGGTGAGCAGCGCAGCATCATGAAAGGCCTCAATCTCGGCGGCGTCGTGGAGTTCTGCCGCGTGCTGACGCGCCAGCCGCAGCTCCTGC
TGCCCCAACTGTCCGTGAAAGGTGATCTGCACTCTCCCAGCTTTAAACACATGCAAAGATAGTGTGAATCTGACCAGTTTGTACGGAATAATACTACTGT
GAAAAATGTCGCTCATTGTGCACGTTCTGCTCGTATCGCTGCTTCAGATGTGACGGAGGTGCCGTTCCAGACGCTACGGGACCGCGGATTCCGCGGCGTT
ATCTTCGATAAGGACAACACATTGACGGTGCCGCATAAATTGGAGATTGCGCCGCATCTCGAGTCTTCGCTGGCCGAATGCCGCCGAGTTTTTGGCGACT
CAGGCGTCGTGATCTTTTCCAACTCGGCGGGCTCCACGGACGATAAGGATGGCGTTGAAGCCAAGAAAATCGAGGAACGCCTCCAAGTAGCTGTGCTACG
TCACAACCAGAAGGTAATAAATGGGTGCGGCGTTGATGCTTGGATGGAGTGGGTGGCTGAGCTGCTTGTGATTGCAGAAACCTGGAGGCATTGCATTTGT
CAAGAAACATTTTGGAGAAGTAGACCCTGAGACGCTTGTCGTTATTGGAGACCGATACTCGACGGACGTGCTCTTTGGCAACCTGAACGGTGCGACTTGT
TGCTGCGGCTGTTGTCTACGCGAGTGTCCAGCTCCACGAGGTTCTGACTGTTGCTGATGATGTGCAGGACTTCTTACGATTCGTACCGAGCAGTTCACTC
CCGAGAGCGAAAGTGTCGTAAATCGGCAGCTGCAACGCATCGAGAAGGCAGCTGTGCGAATGCTGGTACGCGCTGGAGTTAAGCCGCCAACACATCCACT
TTGGGGTAGTATCGATGGCAAGCAGTGAAGCCACGGCCACTATGGGTCGACGGCGATCGGCACGTATTGCCTCCTAGCACACGTAGACTCACGTTGCTAG
TAGCAGCTTGTTACTGGCAACCACTGATTTTGTGCCGTCGTTTTGGGGTAGGATGAGATGACTTCAACATCAATGTAAATGATCCGAGTTCTCCGTTCAT
TCGCCTGACAATGCAACAACACGCGCACCTCACGCAGACAGGGGAAGCACTTGTGTATGTGTATTGCCCCGTACAAGGTGAATCCTACACAGTTGGTTAT
GTCTCCAATAACTCCTCGTCTTGCTCTAACGCACCAGTCTCAAGCTCCTGTAGTTTCCGCTGCTCGGCCTCAAGAAGCTGCTCAAGGCGAAGTTGGCGAC
GCTGTCGCTTTTCCAGTCGGCGCTGCTGCGTTTCCTCCTCCTCGCGCTCTTGGGCGTCGAGGATCCACCGGTACTTCGATTGCGTAAGCCCAAGGAAGTT
CGCGAGCACTTCACCTGCAAAGTCCATGCCGTCGAACGTCTTGGCACCGGACCAGCAGATCCATTCCCAGGCAATTTTCGGCAGTTCCGCGGAGAAGGAA
GTTGCTGTTTGGTTATCGTCTTCGTCTGGTTGAGTGTTATCATCTTGGTCCAGCTTATCCAGAGGAGCTTGCTGCTCGGGCTCGCAGTTCGCCTCGATCT
TCTCGTGATCCTTCGCAAGAGCAGTCATGTTGCGAATAACGCTTTGTGCCAACGAGAACAATGCGGCACATGGGATCGCTCTTTCAACGGGCGGGGGATC
GATCATGAAACCACTGCAACTTGTGTAACGACCGACCGATGCATGCGATTAACCAAGAACTTCAACGTCGCTTTAGCTGACCCCGTGTCAATACTGCAGG
AATTGCTGTGTATTAACCATAAGAAAGCTGCTGGTACTCGCTACTTTGGTTTCGCTCTGCTAGCCCAGGTCACGCACGCCACGACACACTCGATGCTCCA
TAAAATAAATAGCTGTAGAGCCCAGAAACGAAAGAAACGAGCCCTGCCTGCCCCCCTCGCTACCAGTGGTAGTCTACCACTTCACATTACGGTGCACATC
TCGCCATGGCGCTCGCTGTAAATTGACCCGCTGCCGTTCGAGTCTGCAGCGCTAACAAACTCGTTCAAGTTCTTCATTGCCACTGCCACGTTGCTCATGA
AGTACGGCCGCCAGATCTTGCGGTACATGAACTTTGCTGAGAACGGTAGCATGCCCTGGATGCTGCGCTGCTCCGTGTCGCCACCCCAGATCTTGCTCCG
CTCAACAATCCAAGGCACCACCACACGTTTGGCGCGAATAGCGCGGAATACCCGGGGCATGATGTGTGTCCTGAAAGCGCGCTCGGTGAACGCAGCGCTC
ATGGCCGAGTGCAAAGTCGTTTCCTCCATGTTTAATGCTGCATGCAGCGTCCGATTGAGCTGGCGGATCTCTGTCTGCAACACTTGAAGACGAAGCAGCC
AGGACGACGCACTGCAGGCCCCACTCACACACAACGCTCGCTCCAATTGCTGGATCTGCGTCAGCATCTGCGAGATATCCTGATACACGTCCAGAATCTG
CTGCTTGGTCGTCACAGGCAGGTTCAGCAGCGGCAGCAACACCGACGCCTTCACCTCGTGCTGGCACTGCAAATACTCCACAAAGTACGCCTTGAACCAG
AGGAAAAACTCTGCCACGTGCGTCTCGAGTGCTAACGTCTGCGAAGCTTCAGGTTTCGATCGAGTTTGCGACTGCTCCAAGAACCGATCCATGACAAAGA
GAGCGTGGCGGATTGGCTCGTGGATTCCCAGCAGGAACTTGGCGCTCCAGCTCCAGTCAGTCTGCTCCGAGAACACGGCGCTGAAGATGATGCTGCCGTT
GTGGGACGACGGAGGAGGGACCGGCAGGTTCTTCAAGTTGAGCTCCTTCTTGTCCGTCTTGCCATTGCCATTGCCTCGGCCCATGTTCGCGTTCTTCTTG
TTGTTGGGGAACACGATCTCCGGCGTCTTGGTTCGCTTGAGCTGGCCTGGCCGCTGGTTCACCACAGACGAAGCTAGACTGCTGAGGTCGTCGTCGCTGT
CTTCGCAGCTGAGTTCTGTGATCCGGTCGGCTCGGCTGATGGGCGACATGATTTCTTCCGGCTCGGTGTCAGCCGTGGACGGCCCTTGGTCGCTGCCGCC
GCTGCTGCGCGAGGACTTGTCCGAGCTGGACTCGGGCTCCAAGCCCAGCGCGAGACTGCGGTCGTCCCAGATGTTGACGAGTCGCACCCGCTTCGAGTCC
TCGCCGTAGTCCGCGCGGAAGTCCGACATGGTCGTGACCACGTGCGCCACCTGCGCAATGTCGACGAGCGGCCCCGTGGCCAGCCTCTTCTTGTACCTGC
GGGACGTCGCCGAGGCCGGCGAGCTGCTGAACTTGCTGGACCTGGCGCGGCGCCGCAGCGCGGCGTCCTCCTCCTCCGTGGGGCCCCAAATGTTGCGGTA
GAACTCGCAGGGCAGCGCCATCTTGTGCTTCACCTTCTCTCGGTCGTGCAACGCCACGCTCTGGTACGAGCTGGCCACGTTCTCGCCGCGCTTGCTGTGG
TAAAACGAGATGGAAAGTGGCATCTAGATGGTGCGATGCGATGGAGCTGATTCGACTGATGGGGGGATGGTCTGCTGGGCTCCGTCGTCGTTCTCCAAAA
TAATTCGGTGCCGCTGCTGTGTTGCTGCCGGTGGTTGGCGCTAGCGTGGCGTGGCGTGGCGGATCGCAACTTGCAGCCTGAGTCGAGTGTGCAGCGAGTG
TCTCTTGGCGCAGGGTGGCGCTTGGCGGGCCAATTGCCGAGTGCGATGGGGACTATCTTGGGCGGGCGAAACGCAGTTGGGACGGTACCAAGCGAAGCAC
TCGGCTCCAGGTTGCCGAAGTTGCCTCGCCGGTGAGAGACGGAGCAGCGGGAGCCGCTTGCTTGCTGCTTGCAGTTGGTGGCGACGAGACTGGCTCAGTT
TCGTGGACGAGGCTCAGCCACTTCGCAGGTTGCTGCTGCAAGGGAAGGCGCCGGCACCGCGTTCGTTTCGCGCGCGTCCCGAGAGCAAGGAAGCAGGAAA
ATGCCGTCGGACGGAGCGAGGGCAAGTCCAAGAGCAAGTAAGTTGGGAAATGGGACCAGCCCAAGGGTGTAAAGGGGGAGAGGAGAGCCTTCATATCACA
CACCGAGCCTCGACCACTAAAGTTCGGGCGCGGTGGGCTTTACCCTGTGCGCCGCAGATGGCTTCCGGCGTGACATGCCCGAGCCCAAAACTGGCCTGAA
GCGTTAGATACTCTGACAGCGAAGGGCGCTGTTAAGCCCGAGCAAATCGGGCTCGAGCCCCCAATGGCAGAGGCAAGCAATAGTTAACCGTCTCTCCCAA
GACTCGCCAATGCATCGCAGAGGTTCACACATACACACCCAGCGAGGCATGTTCATGACGACCGAAAGCAGGGTAACTGACTCGCCTTGTAAAACGCGTC
CGACGAAGCGGTTCAATCGAGGATGCTCGAGTTCAACATCGAACCTCGTCTGACCAATCAGAAGGCGGGAAAGCGTAGAACGTCTCTTTTTTCGGCGTCA
TTTCAGATATTCGGCGGCGATCTTAGCCCAGCCCATCAACGGCAACGGCAACCTCGGTGGGTCGATTGCAGGCAGAAAATTGGCCGCTCTGCAAGTGTTG
GAGGCGCCAGTGTAGCCCTCGCTCAATCCGATTCAAGAGTACAGCATCTGTTGCCGCCGTCCAGCCGACCGATGGGGGAGTCTCTGGTCAGCGCTTTCAC
CTGTCGCCATGCGTCCCCTTTTCGCCTGCGATGTCCTCCAGCCCGGGACGACGGGTCCACAGCGTTACTGCTGGCAGCTCGGGCTGTGTTGGCGTGCATC
GATCGGCCATGAGTGCAGTTTGGCGCAGTGCGTAACGCGCACCAGCCCAGCGATCACCACGCGTGACGCCCCTGGCCATCGCGCTGGGCACTTGGCACGG
TTCAAGTCGGACATTTTTCGCAGAGCGGATACTATACCCTCTGCGGCTGAGTCCCCCATCGGTGGTGGCAACTTGCCACTGGCAAGTACGTACGAGCGCA
AAGATCTAGGTACTTCAAGTGCAGACGGCGAGCAAATTCGGATTCGAGTAGCTTGATGCATATCACCCGAGCTCCAACAGAGATTGTGTGATACTCGCTA
CGGACCAACAGAAGACCTCGGCAACAATTCTGGGGTCGGATTTTTAACAAAATACTGTAGCTTACCCTCACTGGAAAGCTTCAAAACGTCTACCGGTACA
TGCTGTCGCGTGGGCAACTTGATACTTGTAGCCATTGAGGCAGCATGTTGAGTTGCTGGTCTTTTGACCCGTAGGTGTTACGATTCTTTCGTTCAAGCAA
TTCAATACACATCTTCATCCTCATCAAAAAGATCAAGGAAAGCGAGCTGGATCATGAAAAAATAATGTTTCCTTTCGAGCTTTGCTGCACGTTATCGTGA
AATTGATCCATCGCACAGATCCATTCGACCGAAGTTGTATTACCATATATTGCTCATGTCTTCCTTCATACCTTGGTTCTACCTACTCGTCCGTGGAGAC
GCCGCTGTCCGAGTCCGCGTCCATGTGCGGCGAAATCCCGTGCGTCGTGTCATTCGACTTGGGCCGAGACTTGTTCCGAGGCATGCTCAGGCGGTTCTTC
TTGGCTTTCTTGCGCTTCGGAGTGGTGGGCGGCTCGGCTGCGTCGACGCTCTCCGCCTTGCCATTGCTCTTCTTCTTCGATGCCGGGTTTTTAGTCGTCT
TGGCAGGATCCTCCGAGCTGGCTGGCTTGGTCGCTGCCTTCTTCGACACTGTAGTTTTTGCCTTGGCCGCGGGCACGTGAGTCGGGGTCATCGGCTTCGC
TGCGGCCGATCCGTCGCAGACCCCGCAGACCCACGTCTTCGCCATGCGAGCCGCGTGGCGCTCCGACATGTTGACGCACTTCGGGTGAAACTTGGTGCAG
CATGACGAGCACACCAGTGTGAGCACCGGGTCCTCCTCGCTGGCGCTGCACACGCACACACGAGTCGGTTCCTTGCGCGCAGCAGCGTGCGGTTTGCAGT
ACAGGGCGTACGTCGTGCCGTCAATCTCGCCGCCGCTCTCAACAGCACAGCGCAGGTGGTAATTGCGCCGGCATTTCGCCACGACGCAGCCAACGGTGGC
GCCGAGTTTATGGCAACTGGTGCACTTGAGCTGACGCCCGCGCTTGATTGCCTTCGGCAAGTTCATGATAAGTCCATCCGCCTTCACGTATACCTCTGGC
GAGTGCACGGCGCAGTTCAAGTGAACATACACCGACTCATTGGGCTTGTCCGCGTATTTTAACCGCACCGGGGCCTCGATGAATGGTCCTTCTAATGCCA
TATCAGCCGTAGCAGTGCCCGTTGAGTCCGTACTCGAGTTTCCATTGCGCGCTCCGTTCTTGGATGAAGACGATGCCGACGTTGCGCCATGGCCGTCTGC
GCCCCCTCCCATTACGTTTCCGCGGTGGCACAACGCGCAGATCTTGGGCTTCACGACCGACTTGTCTGCACCATCCAAATGAGTAGATTTGCTCTTCTTC
GCGCCAGAACTGCTCGCCCTTTTCGGCGACGACGCACGCTTGCGTTTGCCGCTTGACCTATCCGTCGATACGTCCTCATCAAGTTCGTCGTCCTCATCAA
GAGGTATCTGCTGCGGAACTTCCTCTCGCTGCTGAGCTGCAGCAGCGGCAAGCGCTGCACCAGCACGCTGCGTAGATCCCGATCGAGATGCGTTCCCTGC
AGCAGCTTGTGGTGGTCTTTTCCCGTCGAGATGGTTCGCGCAAATCATGAGGTTCTTTGAGAGCCGAATGAATTTGTCCGCTGATGGAATGCACTCCGGG
TGGAAGGCTTGCGAGCAGTGGATGCAGCTCACCACGTGTGTCTTGACATCATCCTTTTTCTTCTTGCTTTTGGCGGCGGATTCCTTCTTACTGGCCTGGG
AGCAAGCGTGGCAAAAGTGGCTCGGGCAACGGAACCGCTTTTTGCCAACCCACTCTACACGGGAGCTCTTAGCAAGACAGCCCTTGTGGTAGAACCTTCC
ACACTTCGCTACCGAGCATTGAGTGACACCGAATTCCACACCCATTTCACCAACCTGCTTACAAATCAAGCACATGTGACGCCCCTCCGCACAATCTGGG
CACAGCCACTGCTCGTCGTTGGGCTCGTCTTTCATCCCCACGCACTCAAGATGGAACGAGCGATGGCAGGGGCCATCGCACAGCAAAATTAATCCGCCAT
CACCGCATAGAGTACACAAATCGTCGCTGTCGTTAATAGCGCCGGCCTGGAAAAGAGCAGTCGGAGGCTTACCACCTTCAGTTCGCGGGTGCTTTGGCGG
CCTTCCACGAGGTCTGCTACCGCGCTTTTTCACTGGAGTATCACCGTATGCTTCATCCTCACTACTAGCCGCCCTGCTTCCCGAGGGCGTGCTCCTCCTT
CGCCTTTTCTTCTTCGGAGTGTCGAAATCTTCATCCTGGAACATATTCGTCCGAGATGGCGCTAGTCGACAGCTTCGGACCCGTGACTTCTCTAGCTTTG
ACAAGTACCCCTTCACGAGATCAATCTGCTCGCTGGAGAACTCGTTGCGGTACTTCGAGCTTACAGTACTCAGCACCTGGATGGCAATATCATATTCGTG
CTGAATATCTCGAACTCCCACGCGACCATCGTCCGCACTGTTGCCGGAGCTCATCTCAGTGACCAAGCTGGTGAGAGCGATGTCCAGATTACTGATAAAC
TTAATCTTCGCCTGGCGAGAGCTAACAGCGCTGCCATCTTCAAGCTTCAAGCTCAGCATCTCCACCGACACAGCACCAGGGAGCACCTTCTCCCAAAAGT
TGGGGTCGTCCACAGAAAGCTCACCTGTGGATCCCTCTGCAACAAAAGACGAACGGTCCACCGCCATTCCACCAAGCGATTTGCGTTTGTTTGACTTCAG
CGGCGATTTCCTCTGTCGAGGTGATGTCGGCCCAGCCGCATCGCCATCCGCCCCCTTGTTTGCATTAGATCCGCCACCTACTATCATGACACGGGCGTTT
TCTTTCAAAATGGTCTCAATATCGCGCTCAGCAAACTCTTTAGATGCCGTATCGTCATCCTCCATGAGCGCATACGCTCCACGTTTCAACAATTCCACTA
GCTGCTCCGCTGACGGCTTCGTGATCTGCGAATTCTCATTGAAGGATGCCGTGCCCAACACTGCATGCTCAAGACCAAGCTTTCGTGAAGCACGATCGAA
CATTTCGCTCTCGTACGTGTTGCGTGTCACCAACCGGTAGATCTGCACACTCTTTTTCTGACCGATACGATGGCAACGCGACTGCGCCTGTAAATCATTC
ATCGGGTTCCAGTCGCTATCGAAGATAATTACCGTATCTGCTGCAATGAGGTTGATTCCAACGCCGCCAGCTTTTGTGCTCAAAAGGAACACGAAAGACT
TCGAGTGTGGGCGAGAGAAACGGTCGATTGCACTCTGCCGCATACTTCCACCAGTGGATCCGTCGAGGCGCTCGTAGACAAAAGAGTTCGCCTCGCAGTA
GCGCTCGAGCAAGTCTAGCTGCTTCAGGAACTGGCTGAAAATCAAAATCTTGTGGCCATCCCGCTTCAACTTCGGGATCAATTTCGACACGAGCATCATC
TTGCCAGAGCACTCAATAGTTTTCTCCATCACCTGGGCTGGAGTTGGATGGCTGCCGAGCTCTTCTAGCTCTCGTTCTTCGACACCCTTGATGAGGAATG
GATGGTTACAGCACTTTCGAAGCTGCAGCTGGATGTTGTTCAACGTGGGTAAGCCGTTCTTCGTGCCGCGGTACAGAAAGCTCTTGTTTTTGTCGTAGAT
GGCTCTATAGTACTGTTTCTGCAGTGTCGTAAGCTCCACCGAGATAATTGTTTCTTCTTTGGGCGGGATGCTCTTCTCCACATCTTCTTTCACGCGTCGT
AAAATGTAAGGTGCCAACAACTGCTGAAGCTTGACAACTTGTTCTTGTGAGTGCAACTTCCCAAAACTCGCGTTGAATTCTTCAAGGCTCGCGAATTTTA
CCGGTTCCAGGTAATTCAGCAGGACCCACAGCTCCTGGGTATTGTTTTGCAAGGGTGTACCTGTCAGCAACACCTTGCGATCAACATGGAGAACACGCAT
CATTTTTAGCACCCGAGAACCTGCACTCTTCAAACGGTGCGCCTCATCCACCACAACCAGACGCCAGTGAATATGCTCGAACTCTTCAAAGTCTGCCAAA
ATTGTCTCGAACGTAGTCAGCAGGATGTGGAACTTGAAGATTGAGTTGCCCAATCCAGGATAATACCATTCCTGATTTCGAATGACGGCTCGCATGTCTT
TAGCATTAAACTTGGTGGTACGATCTCCAATATCGTGATAGACGCACACGTTGAGGTCCGTCCAACTCTCAATTTCGCGACGCCAATGCTGGATCGTGGA
CAGAGGCACAACAATCAAAAACGGCCCACGGATCGACTCCTCCGACTTCATATGCTCAAGCAGCGACACAATCTGCACTGTTTTACCCAGTCCCATTTCA
TCCGCCAAGATGCACGATCGCTGGGCTTTGATGCAGGAAACCATCCAGTTGAGCCCCTCAACTTGATATTGTCGCAACGTACGGCCACCTTTGTATGTTG
GCGACTGTTCGTATGGCACGAACTCATTTGCATCTCCACGGTCAGTTGGACCAGAGCCACTACCACGCGGTCCACTCTTTGACGTACTGCTGCGCTCCGG
GAGGAAACTAGCAAAATGCTCGTGGGGGTCGATACTGTTGTCGACGACACCAGCATACAGATGTTGCATAGGTCCGCTCGGGGCGATATAGTTCGAGTGC
TGCATCAAAGTTTGAGTTGAAGCTGACGATGCAACCTCTGGGTCTGCAATTCCCACTTTGAGCATCCGTTTGTACTTGTTGTAACTGTAGTTTGCGTACT
TGGAGTTTTCAGAAATCGCGTCGTCGGGAATTTGTTCCACACGGGTCATCGTCACTTGCTTAGCTTGACAAAACGGCGGGTACATGAACGCTGGTCTCGG
GGAATGGAAGTGGAATAAGATGCTGCTGGGAGATGCGCTGATCAAACTGACTACGTCTTGGAAAGAAAGCCCAGCCACCGAAACGTTGTTCACGGCAACC
AGCACATCCCCGATTGAAATGGCGCCAGATGCCTGAGCTGGGCCGATCATACCATTTGCGAGAATCTGAAATCCAAGCACCGACACACTGTTAGAGCTGC
TAATGCCAAGGCGCATTCCGAGACCGAATGGAGATCGACCGAGCACAACGCAATACTCAGTGAAGGCTTGACGGGTTCCGAACGTGGTTGCAGGATATCT
AGAATCGTATCGAACTTCAGCGCTGACGGTCTCCAGTTTAGTGGGATATCCAAGGGCCACATGTTCAACAAGTGAACTAAGCACTTCACCCACTTCTTCT
TCTGGTTTCTTTTTATGACCCGCAGCCACACCGTCCTCCTCTTCGCCGTCGTCATTTTCCAGGGTCAGGATTCCTGGGTACAAAGCGGGTCGATTAGGAT
AGTCGAGCTCGGCGTCAAAGTCAGCATCGTCGTCGGAAGAATCACCATCTTCGTCTGAATAATCTTCATCGCCGTCGTCTTTAACAGCTTTCGGTGCGAA
ATGTTGCTTCGTGGTGACGTACGCGTTTGTGTACACTCCACACTGTTTGAGCACATCTTTGTCTGGTGTGTGGTTATTCAGCAAGCAATGAAAGGCAAAC
AGTTGAGCCTTCACTTGCTCCGCCATGTGCAGTCGTTGGTATGCACTGCTACCGTATGCCCCGCCCAGCGCCTTAATACTGCGACTGCAGTCACCCTCGT
GGCCGTACCCCAGAGTGCAAAAGCGGTCTTTTTCGCAACATTTTTTGCCGCTCGTGCTATTAGCTAAAGCGTACTGGTGCCGTTTAGCGCAGCACGGCAA
CTGGCACGTAGTTTCACTGATTTCCTTGGCACTAGGTACGCGGCTGAACTTGAAATATCTCTGGATCTGTTCATCGTCACCGATATCTTCAGGACGTTCC
CAGGTTGAAAATCGAACGGACATGCCCACCCACTTGACCAGGAAAAATGTGGCGGCACGATCCTTCACGCTGATTGGAGCTAAACTCTTAGTCGCGCTAG
CTCCTTTAGGGCTTCGTTTCTTCGTTTTCTTGTTGAACTTTCCGTCACCATCGACACGTTCCGTAATGATGTTCGGGATGTGTTTTGAAGTAGTTACCGT
CTTCTCGTCCGAAGGAGCAGTTTGGGACGCATTCGAGGTCGAGGGGGCACTGTCTTCGGTAGCACCTGATGGGACAGCATCGATGGTGTTCGACTTCTTT
TCAGCGATCTCCTGCTTCACGTCTTCCACCTTCGCAATAAACTTAGAACGCGCCCGGCAGTATCCACAGAACCACTCGCCCTCAGGCAACTCAGTCACTT
TGGGGGTAGCACACTGCATGTGCACCTCACCATCGCACCGATCACACAACAATAGCTCTTCGCTGTGGTCATTGTTACCGCACACACAACAGCCAATTTG
CCACGATGCCCAAACGTCGTAAAAAGTTTCAGCTTCACGTCGGAACTCTTTTTGAAGCTGTTGATCTTGCTCCGCATCTCCCGTAGGAGGAAGTTTCATC
CACGCCGTCGGAGACAGCACCCAGTCGTATAACCACTTTTCGAAACAGCGCAGGAGCTCGTCAGCAACGCGCCAGATGTCTGAACCTTCTGCATTGTAGG
TTTTGCAGTTGTTGAACACCAATCTGACATCCGAGGCAAACAACGACGTGGCCGATGGTCCAACGTAGTAACTTTCACGACCAATTCGAGTAGCGACCGT
TCCGAGATCCATCGGATTTGTGATGAAGTTCAGGTAATCGGGAACCTCTTCAACATCGACAGGGTGTTCAAAAATATCTCCTCCGGGTTCTTTCGTCAGC
TTCGTGACGATGCCCAACATACGCTCCGACAGTGCATCAGCATTGTCCATCAAGAAATAGTCTGTCACACGCGGGAACTTGGGCTCATACGAAAGCTGCT
GTCGGCGCTTTTCAATTTGCTCGTCCAAATGGTCAGCCGGGTCCACCTTGTGGTTCAGAATCTTCTCCACCGTCAACTTGTTGGCCTCTAAATCATCCAC
TTCATCCAGCGGTTGGTATCCTTCGCGCCTCAATTTGCGGTCATACACGTGCACGCGATGGAACTTCTGGTATCCCTCCGGAATGAACAGCTCCATCTCG
TCGAACGTGAGCCAGTACAAATGCAAGTACGATCGGCCCAGGAACTTGCACAGATACTCGACAAGCCCCGTAGACTCGTTAATCCTTCGTCCGACAATTT
GGTCCAATTGCGGGTAGCCCACATCCTAATCAAGGACAACAAAAAAATAATAATCAATGATCGCCACTTGAAGTCACACAACAACCGAATCAGAAATAAA
AGCCACGTACGGTCCTCAACTGATAGTCAAGCCGCTGAGCGCGATTCTTCTTCTCAGCAATGGCGGCTTCTTCGCCCTCTGAAATGTCGTCTTCCTCCAC
ATACTTCACCTTCTTCGTGTGGCGCTTCCGACGGTTGCCATCCTCGCTCTTCACTTGTTCTGCAGCTGCCTCCGGCTTCACTTGTACCTCTGCCTTCACC
TGTTCCTTTGACGCATCTGTACTGGAGCTGACTGGGCTCGACTTCGGCTCGGCAACGCTAACCTTCGGCTCCGGAGTGTCCGTTGGGGCGGGAGACGCGG
CGGGGGCTTTCTCCTGCTCGCTGGGCGGTGCGGGCGCTGGCGATACGTCAAGAGCAAAATACGAGCGGCGTCAGTACAACTTAACCCATTTATAGTTAAT
AGCGTGGGCGTAATCGTGACGAAGGAAGAGGCAGAAGGCCTTGAAGGCGGCTTCTGTGGCCTCCTCCACCCATTCCTCGCAGTCTCTGCATGCATGCGGA
CGCACCTGGCTCAGGGGTGGCGCTCTCCATGGGCCTCGCAGGTGGCCGCGCAGACGAAGCAACAGCAGCGAGTCTGGGGTCCACGACGCCAGCGGTGGAG
CAGCCGCAGGGACTGGCAGGGCGCGCTGTTCTCGTACGCTGTCGAACCGCGAAATGGCGCAGTGCACGGAGCTATGTGGCACACACCAATGAACAGAAAT
GGCTTGGACTTTGTATGGTGCAATTCAATGAATTGAGCGCGGTGGCGGGCATGGCTACACTTCGGTGGCAGACATGGCAACAGCAAGGGCGAGGAGAGAG
GACGTCATGTCAGTCTTAACACTCAAGGTCAGTGCTGGCGGCGAGATTGTTTTGTCACGGCGGTAGATTTTGAGGGGTGCTTGGCCGCTGAAAACTTGGA
CTCAATATCTCGGTGCTGATTGAAGTTCATACGTCGTGAATGACGCGTAAGTACACTTATCTGCCTGTTTAACAGTGCGTCTTGACAGACCCCCCCCCCC
CCCCCCCGTAACTTCTCGGTAGTCGCGTTTGTTGACTCATCGAAACTATGGGCGTAAGTATGCTTGTCGGCGAAATATGTGACCAAAAGATTCGTGTTGC
TGATGAACGATCGCACTAACGTGGTGTCACCGCTCGATTGTGAATCGACTCAATGTAAGGTGCCAGTTGCGTGCCTACAACCAGTTCCGTGCCTACTTGT
TTTAGCCAATTAGCATCTTCTCCTTGTTAAACTCTCGTAGTCTATTGGTAGATTTTTCCAGCGTCACATGCAATTTCCGGTGATGAGCCTCCTAGGATTT
GCATTGCATACAAAAATGCTATCAAAAAGAGGCAGGAAACTGGCAGCTCACTCCAAATCAACAAGCTTTTCAAAACAATAACAAGAATTTCTGCAAAATT
TACACGGACCAGCGTGAAGTACATAAATTCAGCCCAATCGCGCAGATTTAGCGGGTGCAATCAGATTTCAGAATGGGCAATTCAATGAAAAGTTATGCCA
CAGCAAGTCCGCAAGTTCGAAGGACGGCACGAAACTGGCAGAAGACCTTACGTGAAACTTTTCCACAGTGACACCAACAAGCCCACACAGCGATACAACG
AAGAACTTCAACTGCACGCTGCAATTATCTTACCACAGTGCATCGCGAATTGTTGGCAGTGTTGACAGAACCAGCAACGTCAGACTGACATTGTCAGCAG
TGCTGTGAAGCTCAGCAATTTGAGTCTCAAGCGACTCGGCAGCGATCGAGATCCACTCCAGTGCATGCAAACAACGTTCACACACGTCCACTGCGTTAAT
ACATGTACGCATTGTCTAGTGCGTGCTGTATAACTGTCTTGCTCAATGTCCAGCGCTTCGGCTCTTGCAATCGCAACTCGCTGAGCTCACCCTGGGACAG
AGTTCCTGCAATCGTGGTAATGCATAGAGTTGGCTCTTGGCCAACAAGGCCCTAGCTCCGCAAGCTGCTTCCAGTCCACAACACTACATGCTCTTGCCGC
TACCCTATCGAAGTACCCGCTCAGCGAACACAACGATCGAGCTGGAGCTGACACTCGTGTGCCTGTCGTTGAGACACGGA