Description :
From Genome Similarity Track
Location :
Scaffold_77:32124- 33910
Sequence
1786 bases(100 bases per row)
CTTCCGGTCTGAGTTGCTTCCAATAGCCCCGCGTTTCTCCAGACTGGAGATCCAAGGGCACTTCGGCGTCAGAACGGCTGAAGTCGTCCGATCGATGTAG
ACTTAAGACCTTGGCGGTAGATTTCGCATGCAGATCACATGTATTACCGCGTAGATCAGTCCGTCCACTTACTCGATCTACCGTGTTGTTGTTCACGAAT
GCATAGATGCAGTACCTAGAACGCTCGGCTCGTACCGGATTCCAACCCGGCGAGCGTCCTAGTTTAACATCTTCTCGTCGATCGCGGGCAACATGCCAGC
GTGCTTCACACCATTGACGGATCTGGTTGTTGAATTCCTCCATCGGGCACTTGCCCATCTCGTGTAGTTCACCACATCCACGGCACACAAACAGGCAGCG
ATCCGTCGGATGACCTCTCTTGCCACACTTCTCGCACCTCAAACGTCTCCAACAATCGAGATCGGTGTGTTTCCGCGATCCACAATGTGAGCAGCGGTTT
GATCGCTCCGAGCCGTCAGGTGAAGATAGCGATCGTGGATCCGATCGAGGTGGGTCATGGTTGATCTGCGCTTGGTTGCTTCGATCCGGCTTCGTCGCGT
CGCCCCCAGCGTTGCGGGACTTGTCCTCGGCCGACGCTAGGTAAACGCGACGTAGATCACCCTCTGAGTCCGATCCGTCTGATCCCGTGTCCGATCCAGA
CTCCTGGCTCGCGATCTGCACTGCACGCACTGCCCGGTTGGTTGCAGCAGCTGGTGCTGAGGTCAGAACCTTCTGAAGATACTTCGATTCAAAGGCAGAT
CGCTTCTGTCTGCTCTTCGCGCGCTCTCGAGCGCGCAGGACTTCCTCCAGATCTTCTGCGTCCGCAAGCCGGAGTATAGTGAGCCGATCGGCCAGGTCCG
GATCGCCCAGCGTCTCGATAAAGTGTTCGACATGTTCTCGGCGGGCCTTGGAATCTCCGTCCTTGATCTTCAATTTCGCACACAGAGCCGCCACATTCAG
TCGATAGAGGTACTCCAACGGCGATTCATATGATCTCTTGCGAGAATGGTAATACTGCCAAGCGGCCGATACTCCCAGGCCACAATACTGGATCTGGAAA
CTCCGGAGTAGATCGCTCCACTTGTTCCGCGTCGATCGGCCCAGCTGGCGGTACCAGTTCTTCGCCGGGCCCGTCAGTTGATCAGCGAAGGTCAGGCACT
TCTCTTCGTCCGTAGCCTGATCTCGCAGGGACGCCGATTTCACCTTGCTGGTCCACGATCGGGCGCGGTCTTCGTCCTGATCCTTGCCACTGAACTCCTT
AAGATCGGGCATCGCCGAAATCCGCGCACGCTGGATTAAGGAGGACCCAGTGGATCCTGAGGCAGCGGTGACCACCGCAGCAGGGGCCGAACTCGGTAGA
TCAATGTCGTCCAGATCGTATTCCCACTGAGAGGGATCTTGATCCGGCGATCCGGCTGATTCCATCTCCACGTCCCGCGATCCAACGTTGTCGTCGACCA
CTGGAGTAGGTGTTGCCACCGTGGCCTGTTGTTCCTTCAGAAATCGAGCCATCGCAGCCTGAAAGTAAGAATCCAGTCTGTTATTCGACGCATCTGATCC
GGTAGCACTGGTGGTCCGATCGGTCGACTTGGGTTTCTGCTTCCGAGGTCCTGATCGCATGCGTTCCTGACGTTGATTCCGTGATCGTGCGTCCAACATC
ACAGATCCTGAAGGGCCGAGGGGCATCCGTTGAGGTTCGGACGACGTATCCGATACATGTTCCGCTGCGAAGACATAAGGAGACGA