Description :
From Genome Similarity Track
Location :
contig_7:32114- 34709
Transcript NameFunction/comments
g1990.t1hypothetical protein

Sequence
2595 bases(100 bases per row)
GGCCTTGGTGATCGGTAGCTTGTGGGTAGACTCCCAGAATGCTTGACGAAACTTCTTCGAATGCCGCGTACAACTGTACGAACTCCGCGAACCATCCTGT
CGCATCAAACGATCGCGGCGGAACTGCCCGACCCAACACAATCCATGGTCGCAGTTTATACAACGCCAAGATATTAGCCTGGGTGATCAAGTCGGGATTC
CAGGTGCCAGCAGAAGGAGTGCGGGTCCGACGCGGGAATAGCCAAGATGGCGGACGACTCCACTGACGAAATAACGTGGCGACCGTCAAATGGCGGACGC
TGAGTTGACGAACCGGAGAAAGAGGCCAAGGGTCCACGTCCGTACCGCGAACCTTACAGGACTCCGGTACCCTGGGATCCAACGGTCCCGAGAGATGGTG
GTGGGATCGAGCTGATCGAGCTCGGCATCGGACAAGACAGAGTTCGCTGAATCGCTGCTATCGGAATCGCCCGAGTGGTGGTCGCCGGCGGAGCTGCCTC
CGGACGAGTCACCGCCATCACCGCCGCCGTCACCGCCGCCGTCATCGTCGTTGTCGCCCTCGTGGTCGCTGTCTTTGTTATCGCCGTCGTTACCGTCATC
ATTGCGGTCGCCGTCGCCGTCGTTATCGTCTCATCGTCGTCATCGCCGTCGTTACCGTCGTCATTGTGGTCGCCGTCGGCGTTACCGCCATCGTCGTTAT
CGCGGTCATCGTCACCGGCGTTACCGCCATCGTCGTTATTGCCGTCGTCGCTGGCTTGGCCATCCGATCCACGATCGCTAGAAGAGTCGACGTTGATCGG
CTTGCTGGGGTACCTGCTGCGCGACGCTTCGATCGGGACAAATGTGATCGTCTACCAGAAGAACGCGATCGAGCGAGACCGGCGTTCAGAGCGTCATCAT
CGTCGCTGTCGCCGGATGAAGGAGATCGGCGACGTCGAGACTTGTGAGGCCGCTTGCGACGAGACGACGGACTTGATGGAGAGCGACGGGAAGGAGAGCG
GCTGGCGAGACGTTTCCGTGATGGAACCTTTTTCAGCAGGGAGGGATCGCTGGCTGGCGTGGGAACAGGAGTCGCCGGAGGAACGATCGAGCCAGGTTGA
AGTATGCTGGTGATGTCCGAAAGGCGCCGCAAAGCACCGTCTCGCTCTGTGATCAGCTGATCACGCACGCTCTCCAGATCTTGTTGGGATTGACGGGCGG
TCGCGAGGTCAGCACGCAACACGGCATTAGTGCTGCTCAGCTGGTGGTTGGCGGCTACCGAAGACTGGAGGCTGCTTGCTCGCTGCTCCAGCCGAGCTAT
GGAAAGGCGGGCGGATGTGACTTGGTTACCTGCAAGAAAGAGAAACGGGATTAGATCAACGGACGCTGAAGGATCGACGCGATTACGTACGTGCTTGTGA
AAGCTCGTTCCGAGCGCGATCACGTTCTTGGGTCACCCGTTGTAGTTTCGCCGCTTGATCGCTTAGATCTTGGTCGGACTTGTCCAGTAGGTCCTGCAGC
CGTTGTCGTTCCTGAAGACTCTGGTCGAGGGCACGCCGGGAACCGTGTCGGGTTTGCGCCAACTGGTCGCGCAATTCGGACGCACGACGCTCGAGTAGCG
CCACCTGTTGCCGGAGGATCTGCGCCGATCCCTCGAGAGCCTTCTGGGAGGTCTCGAGATCGCGAATTGAGTCGCGGGCCTGATCCAGATCGCGGTTCGC
TAGACCTTGGGCTGCGATCGCCACGTTCAGCTGGGATTGGAGTTGAAGGGTGGTCGGGTTGACCCCAGGCGGAGGCAGAGCTGTGTCACCAGAAGTCGTG
CTGGCAACTGCCAATGCAGCCGTTAGACGCCGCTCCAAATCATCGATTTCCCTTTGGAAGTCAGCGACGGCTTCCGCGTGTACGTGATCTTGGAGGCGCA
TACGATCACGGAGGTTGGTGAGCTCGGTTGCATTGTCGAGTCTCCGGGCCAGAGCTTCTCGGGTTTCCGCTAAGTCCAGGATAGACTGCGCGAGACGATG
GGACAGCTGATCGTACTTCTGTTGGACGAAGCAGACGAATGGGGACGCCGACTGAGCCGAACGAATTGTGTGCTCCAGGTCTGCCACACGTTGTCGCAAG
GCGAAGTAGGACTGCAACAAGTCGTTGTAGCTGCGCTGGAGTGCCTGAAACTCACTCTCGCGATCCAGAGCGGCTTCAACTGCAGCCAACGATCTCCGGA
TGGTGATCTGGTCTAAGGGCGGCAACGAGGAACCAGCTTGAGGCAACGACTCGGTCGAGAGATCGCCAGGTTGACCTTCGATTCGGCGTACATGTTCGGA
GAAAGCTGCAGGAGTTGTGACGGTGGCATCGGAAGCCACAGGAACAGCGGTGGACGAATTCGAGGTCGTAGCCCTCTGCGGCGACGAAGGAGATCGGGAA
GAGCGGGCGTAGGCGAGTGGGAAGAAGGATCGTTCGGGGAACGCCCCTGATCCGGCGAAGAGTTGTCCGACATGGTGCTGTGGAGGTGTGGTGGCGAGGA
GCGATAAGAAGAAGTGACGAGTGTGCACGCCAAGACTGTTGGGCAGCCCCGGCATGTACAGGGGGCGATTGTGGTGAAGTGGATGTTGGAAATTT