Description :
From Genome Similarity Track
Location :
Scaffold_1:321110- 323105
Sequence
1995 bases(100 bases per row)
ATGCCATTCCTGCCGTGTTTGTCCCTTGGAAGTCCAATTATGAAATCCATACTCACAGACTTCCAGCTGTCCTGAGGGACAGGTAATGAACGAAGTGGGG
CCTGAGTCGAGCCAGATGACTTAACTCTTTGGCACACTTCGCAAGTACGCACATACTTGCGAACTCACTTGTACATGTGTGGCCAGTAGTAATCTCGCGA
CAAGTTGAGAAACATTTTCTCGCGTCCGAGATGGCCACTCGAAGGACTGTCATGATACTCGTACAAGAGTCGATGACGCAGACCTTCATCGTTGGGGACA
ACGATCCTCGCTGGATCCCCTTCGTCAACCGCATAATACAACAGCTCATTGTGCATGCTGTAACGGTGAACACGCGATCTTGCTCTTGATGGGAGGTTCT
GGAGTGCCTTGTCTGAGGGATTCTTGAAATACTTGATCAGTTCTTGGCATGCTTCGTCTTGCTTGTAGCCCTCAGTGATTTCTTCTTGGGCTGTGCTTGT
CACTTCCGTGGCAATTGCATTGACGTCTTCACAGAGTCGGCACGCTCCATTTATGTCGTCACTCTTGCTCTTCGGATCGTAATCCGGACGTCTTGACAAT
GCGTCAGCAAGTATGTTGGACTTGCCGGGCTTGTAGTGTGCAACAAAGTTGTATTCAGCAAAGAAGGAAAACCATCTCGCCATTCTTTGCGGCAAGTGAG
GAGTCTTTACCGCTGTCCGCAATAAAGCGTGATCAGTGTAGATAGCGAACAGCTCTTCACCAAGCAAATAGACTCGGAACTTGGCTAATGCATATTTCAT
GGCCAAAAGTTCCTTTCGGCAAACGCTGCCTGATGTTCCTCTGACCATTCCCACTCATTTTCTTTCTTCAAAAGACTCGTGAGGGGTTGCACTAACGCTG
CGTAGTTGCGCGTGTATTTGTGCAAATAGTTGGCCAAACCCAGCCACTGACGTAGCTGTTTGACGTTCTGAGGAATAGGCCAATCGTCAATAGACTTGAC
CTTCTCAGGATCGACCCGAACGCCATTCTTGCCAACAAAGCAACCGAGTACAGGGATCTCGGGGGCAAAGAAGATGCATTTCTTCAAGTTAGCGTACAGT
TTGTTCTCACGCATAACTTGAAAGACTTGATGAAGATGTCCAAGATGAACATCGACATCTTTCTTCCCCTCCGAGGCCTTGCTGTGAACGAATATGTCGT
CAAAGTAGCTCGGTGCAAACTCTCTTAATGGACGAAGTACATTCGTGACCATTCTGTTGAAAGTTGCTGGTGCGTTCTTCAGACCTTGTGGCATCACCAT
CCACTCCCACAGCATACCACTAGGGGTGCTTACTGCTGTAAATGGTACATCACTCTCACGCATACGAATCTGATAGAATCCATCTTTCAGATCGATCGCG
CTAAAGACAGTGCTGCCAACCATTCCATCAAGGATCATATCCTTTCGTGGAACTGGAGTCTGAGCAGGTATGGTCGCATCATTCAATTTGTTGAATCCAT
GAACAATGCGCCAACCGCCTGTGGCCTTTTTAACACAAAAGGTGGGACTACAGTGCGGAGACTTGCTCTCGCGCACATGGCCAGCCTTCTGTCGCTGCGC
GAAGAACTCATCGATCGCATCGACTTGTTCCTTCGGTAGCGGCCATTGCCTTGTGATACAGTACTTTGTTCCCGGAAGTACATCTATCTCGTGACGAATG
CCTCTATCCTGCGGCAATTCGTCCGGCACTTTGTCTGGAAATATGTCAGCATATTCCTTGACAAGTCCATACACGGGGTTTGTCTTTAGAGCGTCCCACG
ACTGCTCATCAAACCTTTCCGTCCGTGTCCTTTCATCTAACACTTCCGCAGTGTTGATAGCATCACCGGCAACTTCATCGACGATCACACAAATTTGCGA
AATTTCGCCTTTCACCAGGCTACGCTTAAGCGTCTTCTTGCTCATCAACGGCAAGGAAATCAATTCTTGAGCCAGACTTGGAGGATTTTCCACTT