Description :
From Genome Similarity Track
Location :
contig_47:321076- 323825
Transcript NameFunction/comments
g9246.t1RAW31263.1 Glutarate-semialdehyde dehydrogenase [Phytophthora cactorum

Sequence
2749 bases(100 bases per row)
CCCCAAAGCGTGCATAAACCGCTGGGTGACTCTACTGATACCATGAATTCGCGTCGTTCCACCGGCAGTATTGGGACTACTCGATCACTCCAGTGGCAGT
ATCGATATGGTTACGAATACGACGCTGACGGTAAGCTTGTCAAGAGCTCCAGGTCACAACCGCGGCCTATATGGACCGAACACACTGACCCTGACTGCGG
CATGGCCTATTACTACAACGTGCTCACCAATGAGTATCGATGGGAGAAACCTGCAGACTTCGACATCAACTATGAAGCTTTTGCTAGCGGACGTAGTGCA
AGCAGCTCCGCTCGTAAGTGGTTCGAGATGGCCCATCAAAAGCAAAATGCCGACGGCAGCAGCTCTCTCAGTTCTCGATCGTCGAAGACGCGCGCTTTCG
GAAAGAAGTGGGTGGAGCTGGTCGATCCAGAGACGCAAAACACGTACTACTACAACGAGGTGACAGGAGAGACGCGGTGGTCCCTCTCTCCTCGCAGTGC
ATTGGACACTTCAGATACGGAAGATCAGATCTCCTTGGCCCTGCTCGCGCAGGTGAAGCAACTTCGCGAGACGCCAGTGCCGTATTCATCTCGGGACCAG
CATATGAGCTGGCTGGAAGCAGCTATCGCCGAGAAGGGCTGGAAAAAAGCAGACGCGATCGTCCAGCAAATCTTCATTCGTGAACAGAGCCAAGCTGTAA
CTGACCGTCGAGCTAGAATCGCAGCCGAGGAAGCGGCGAGAGCACCTGTCACCTCAGATACAGCGAGCAATTTCTTGACAAGCAGCAATGTTTCCTCTGT
TTCGACTCCGAGCGCTTGGATCGAATGCACTGACGAAAGCAGTGGCGCTACGTACTTTTACAACCAGGTGACCGGAGAGACAACGTGGACCAAACCATCA
ACAGCACCTGCAGGTCAGTGGGAAGTGGTGCAGGATAACGATGACAAGGCGTATTACTACAACCCTGTCACAGGCGAGACGGTATGGTCAGAGCCCACCC
GGTGAGTTCGAAGGAACATATAACTTTATTCCACAGTACACGTCTGGGTCAAAACAATCTGGCAATGGAAACTTATGCCTCCAGGCCGCCCATGCAGACC
ATCTTCGTCTCCTGATACTCGTCCAAGCCCATGAACGAACCTTCACGACCGAGGCCAGACTGCTTCACGCCGCCAAACGGAGCCTGCACGTTCGAAATCA
CGCCCGTGTTCACACCGATCATACCGCAGTCTAGCGCAGCAGCAACGCGCCAAGTGCGAGACAGGTCCTGCGAGAAGAAGTACCCGGCCAAGCCGGCCTC
CGTGCCGTTGGCCATCTCGATCACGTCCTCTTCAGTAGAAAACTTGAACAGCGGTACAACGGGTCCGAAGATCTCCTCGCTCCAGACGCGCATGGTGTCG
TCAACGTGGGCGAGCACCGTAGCCTCGTAGAAGTTGCGGCCGATGTCACTGCGCTTGCCGCCAACGAGAGCCGTCGCGCCGTTCGTGACAGCATCCTCCA
CGAGCTCCGAGGTCTTGAGGAAGGCGTTGGGGCCAATCAGCGGGCCGAGGTTCACGCCTTCTTCGCGCGGCGGGCCCATTTTGAGCTTCTTGACGCGCTC
CACCAGCTTGGCCGCGAACTCGTCGTAGATGCTCGCATGGATGAAGATGCGGTTGCTGCACACGCACGTCTGGCCGGTGTTGCGGAACTTGGAGGCCATA
AGGCCGTCCAGGGCCTTGTCAACGTCGGCATCTTCGAACACAATGAACGGCGCGTTGCCGCCGAGCTCCAGCGACACGCGTTTTACCGTCTCGGCAGATT
GCTCCATCAGCAGCTTGCCGACGCGAGTAGAGCCGGTAAACGAGATCTTGCGGACGTCGTGGCTGCTGGTGAGCGCTCCACCGACCTCGGCCGCCTTGTC
ATTGGGCGACGGCACCACGTTGATGACTCCGGCGGGAATGCCGACGTCCTCCGCCAGCTTGGCCAGCGCCAGCGCCGACAGTGGCGTCTCCGCAGCAGGC
TTGACCACTGCCGTGCACCCTGCAGCCAAACAGGGCCCCAGCTTGCGGGTGATCATGGCCAGCGGGAAGTTCCAGGGCGTGACGATCCCACAGACACCCA
CGGGCTCCTTGATAGCCAGGATCTTGTGGTCGGGCGCCGATGTGGACGGCAGGAAGCCGCCCGAGTGCATGATCTCATGCGCGTAGAAGTCAATGAAGCC
AGCAGCGTAGGCCACCTCGCCCTTGGCCTCGGGCTGTGGCTTGCCGCTTTCCACGGAGGCGATGACGGCCAGGTCCTCCGTGTTGGCCACGATGGCGGCG
TGCCACTTTTTGAGCAGCACGGAGCGCGCGGCGGGCGTGGTCTTGCGCCACTTTTTCTGGGCCGCCAGCGCCGCCGCGATGGCCTCATGGGTCTCGACGC
GACCCATGTTGGCCACGCGCGCGATCTCCTTATCGGTGGATGGGTCCATCACGGCGAAGTGCTTGTTGGAGTGCGCCTCGACCCACTTGCCGTTGATGAA
GCCCGCCGACTGGATCAGCTCCTTGTTGTGCACCTCGGCGTGGAAGAAGCGGCGCGTGGCCAACGAAGCCGATGGCAGCACGGAGCGGTGGATCTTGGAC
GACAGCATGGCGGAATGAAGGGCGAGCGGGCGCGGTTTGGGCTCGACGGTGCAAGTTCGGAAGTGAGCCGTTGCGGAAGCAGTGCTTCGACCGCCAGGAC
CACTACTTGGCGTTTGTATGGGGTACGTCAGCAACGCGTACGCTCCCAA