Description :
From Genome Similarity Track
Location :
contig_38:321057- 322457
Transcript NameFunction/comments
g7118.t1hypothetical protein PHYSODRAFT_293792

Sequence
1400 bases(100 bases per row)
ATGCTGTACGCTCGCCTATTAGCAGCGTCGGCTCTGGCGAACGCTCTCCTGTTCCGCAAGTCAACTCGGAGGACTACACGGTCAAGGCCGATCCCGCTAC
GACACTTATCAGTACCTGGGAAGGATGGGGCACATCGCTCTGCTGGTGGGCCAACGCCTTCGGAGACCGTGAAGACATCGCTGACCTACTCTTCACCATG
AAGGATACCGTGACGCTCGACGGTGCGTCATCTGGTCTCCCAGCGCTAGGCTTCAACATCGCGCGCTACAATATCGGTGGGTCTGGCAAAAACGTCATCG
ACGACAGCGGCACCGAGATCGCGATGAAGGAGTCCAAGAACATGCCAGCCTTCAAGTTCATCGAATCGTTTTGGCTCGATGGTTGAGCAACGACACAGCC
AGCAAAAGCTGGAATTGGGAAGCTGACGCTAAGCAGCGCAAAATGCTCGACTTGGCGACTCAGCGTGACGTTGACATCACGGAGGCGTTCTCAAACTCGC
CACCATGGTGGATGAACAGCAACCACGCGACTGCGGGCGGGGACAGCGGAACAAAAGATAACTTGCAATCCTGGAATCATGGACAATTCGCGCTGTACCT
GGCTACCGTAGTGAAACAGGCCAAGGAAAGCTGGGGAATCAACTTCACGTACGTTGTGCCGTTCAACGAGCCTATGAGTACGTGGTGGCAGTATCCAGGT
GGCCAGGAAGGCTGCCATTTTGAGGTGGACACCCAGAAGATGTCGTATTGAAACTGCGCTCTAAGCTGGACTACTTTGGGCTGCAGGACGTAGCCATTTC
CTCATCCGATGAAAACTCGGACACGCAGGCACTATCGACGCTCACTTCCATGTCGACGGACGCAGATGTGATGACTGCCATCGGAAAAATTAACACACAC
GGCTATGGTAACCGCGAGTCGGATCGGGCACCACTGAAGAAACTCGTGGAGCAGGTAAAGAAGAAGTTTTGGGACTCCGAGTACGGCGAGAAGGACGCGA
CGGGACTCAGCTTGGCTGAGGCTGTTGCGATTAACATCAACCAAATGGGCGTGTCGGCGTTCGTCTACTGGCAGCCGTTTGACGGCGGGGGCTGGGGCCT
CATCAATTCTGCTCCGGGTAATTTGACGATCGACACGCCCAACCCCAAGTACTATGCGTTTGCTCAGTACTCGCGCCACATTCGACCCGGCATGGCGATC
CTTTCTTCGGATGACACGAACACCGTCATGGCCTACGATACCGCGTCCAAACTCCTTGTACTTGCAACAGTGAACTCAGGCGACACGGTTTCGAAGGTCA
CTTTTGACTTGGCGAGCTTTTCGAAAGTGACAGGGCCGATTAGTGCGTGGACGACGGAAACGAGCGGCACGGGTGCGCTTTACAAGTCCTCGAAGGTCGA