Description :
From Genome Similarity Track
Location :
Scaffold_165:32104- 33414
Sequence
1310 bases(100 bases per row)
ATCTTGATTTACCAGAACTTCCAACTTGGTGAAGTACGGCTCTGTATACGTTGCTGGTGGCGAGTTCTCACTCCAACCTGGGTCGGGGAACTCGGCTCAC
CGAACATTGTCCAGCGTTGGTGATCATTTTCCTCTGTCCAGCGCAAATCGTAATCTAACGACTCATCCGCTGTAATCGCCTGCAACACCGAAGGCATAAC
ACAATATCCTCGTAATGCTCTTTGAGCTCGGGTCGTTGCACTCTGTAAGACCGACCACACCGGTTTAAGCGATTCTCCGATGCTGGTTGATAGGTATGCA
GCAGCCTCAAGTGTTGGAGACGTCCTGGAGCCGACTTGATCGCCATCAAAATTATCGTCATCGGCTCCCAACCCAGCCGCAGCAATGTGCTTCAGAACCG
AGTAAACCTTGGCTTGCTCGTTGTCTACAGATGAACCAGAATCGCTTTCGATTTCGCGGCGAGTTGACCGGGGTGGATCTTGTTCAACAGCATCAACGTC
GCTGTGTCCTCCATCCGAGGTAGCAGCACTACTATCGTCAGCAAGTTCTCCACACGATAAATCACTTGAACTGTCAACATCAGCAACAGCAACGAAACCT
GCAAGTGCCCCGTTGGCCTCGCACGAGCTGCGGTACCGTGCTGATCTTTCCGAGTTTTCTTCCGAAATGACGCCACCAGCACTTTGGTCATGACTGCCAG
AGGCAATTTCAGGAGCTACAACGACTTGATGCTTTTTCGACTCCTTCACGCTCAAACGACGTGTTTTTGTCGGTGGACGAACCTCGTCAGTTGTCGACCC
CGGAACTAGGTCTGTAGTTTCAACTTCACGGGGTCTCTTCCTCTGCACTCCCTCCGAAGAGATGCCATTAGGTGTAGTAGTTACTGCCGACTGGTTCGAC
GTGCTGCTCACATCGCTCCCTAGAACCGCCCTCTCAGCTCTCTCAATCTCCGCCAGCACGTCGAGCCTCCTCCTAATCACCACTGGGGTCTTCAGCACCT
TCCAGACTTGCAGGTCACCGCGTCTTATCGTCTGAGACTCTCGCAGCAGCCCCATCACACGCACCATCAACCCTCCCTGCTCCATGTCATTCTCAAAGCA
GTAGACCTCCTTCATATCTTCACCAGGAGCGAGTCGCAACCCAACCCGAAGCATCTTGTGCCACTCCCGCCTCTTCACCACTTGCAATTCTCCCACGAAT
CCCTCTGCGGTCGCCGGCCACACCGCCACACACGAGGCTCCTCCATCCGTTCTCTCGAGCGCATCTGCCACCGCCTCAAAGGCCCTCCCCAACGTCGCCG
CGCCCTCCAT