Description :
From Genome Similarity Track
Location :
contig_15:32102- 33933
Transcript NameFunction/comments
g4143.t1hypothetical protein

Sequence
1831 bases(100 bases per row)
CCATCATCAGCGTCCCGTCAACACAGGAATGATTGCGGTCCCACTGAGTGAAGGTCATACCGGTATCCTACCGGTATACGACAGCTGCCCGAGGCGCCTT
CTTGACAATATGTACCCATGTCTATTGAGGGTATGGAGGGTATGGAGGGTTACCGGTTTGGTATCGGTTGTTTACCGTGAACCGGTTAACCCGAACCGGT
CCAATCCGAACCCACGCCGATTACGCCACCGACGATTACGCCACTGTCGATTACGCCACCTGTGGGTACAAGATTGTAGGTACAAGATGGGCTTCGACGT
GGCGCTCTCTCATTGGCTGAAGTAACTCAGTATCCAGTAAAGAATCAAGTAGTGTGTATCCAGTAGGTCTAGAGTAGCGAGAAGGCTAGCGAGCTAAAGA
CCTCAATCAATCACTTTCGAATCTTCGTTCTACCCCTCAAGTGGTTTCCAGTCTCCGCTCCGGTCTCGCCCAGAGTGCTGCCCTCCCTCCGCTCCGTCAA
GCTTCACGGTGTCCAAGATCCATACCTTCCATCAGGTTATGAGCCCAAGCACCATGTCCTCTGCCCACGACGCCTCCACCAAGGTCTCCATCGACAAGTT
CAACGGAGACAACTACGCGACGTGGAACCGCTACATGCGTGGCGTGTTCCTGACCAAGTCGGTGTGGCATGTCGTGAACCGAGAGACGACGCCGAGCTTC
ACGGACTCGCGGCCCAAGGACGAGTACGTCAAGTCGAGCAACATCGCGTTCGGACTGATGTTGCTCCACATGGACGCGGACTACCACCATGTGGTCGACG
ACTGCGAGGAAGCGTGGGTTGCGTGGACGCGCCTGAAGACGCTGTACGGTGGTTCGCAGAAGGCTGGTCGCATCTACCTGAAGCGCCAACTCTTCAGCAT
GGAGATGTCGGAAGGCGGGAATGTGACGAAGTCGATGAAACTTTCTCGCCCAAGTGTATAGCGGTAGCCTAGACTTAGTCCTGAAACTTAAGCCTGGGGG
GTGTAAACCCTGAACGCGGTTCCTTGAAACCGTGATTCAGAGTGGCATGGCACCTTGTGTAATCCCTATCGGCGTCGATTGCTTCGGGGGAAGCCCGGAT
ATATCACTACAATGAGTTGTCAAATACAAATAGGCCTTGAAAATGCTGAGCGTAACGTCCACTTCCTGAACGCACTTCTCCAATGTCTGGAACCGGTATC
GAGAACTCGGAACAAACACCACTTTCAGATACCCAATACAAATACAGAGTTATATACAACACGCAGCCGTTACTTATTCTTATAGACCCTTGAACGGTGG
GTCTGAACACCAGTCAACTAAGGCTGAATCCAGGATACTGGTCAATCCTGAAGCCTTTTCTTCACACGCGCACCACCCTCAGATGAGGGAAATAATACAC
ACCAATACAATCCTATCTCAAACGCAGTCTATCAAATATTCCTGGGGATGACTGCTACTATCACCCAAGAAGGCCTTGTTAATATGAAATGAAAACCCCG
CCCTTACCGTACGCGCAGCGGGTCCAACTAATATAGGGAATGCAAGGATCACGTCAAATACTTACGTGAATGATCCCCTCGCAACTGGGCTTGAATCTTG
TAGAGAGCCCCGCACCGAACTGCCCTTAACTGAACGGCGGACCCGTGTCCTGCTTGTCAGAAGCTCACTTACTTTGAGCGACTTGCGTAGTAGGGGGTTA
AACGAACTCTGATTGTTATCTTTGCTAGCCATCGCTAGCTTCTTCGTAAAGGGTATCTGTCTGTCTTCGTTCTTCTGTTTCTTCTGTGTTCTTCCGTGTT
CTTCAGTGTTCTTCTGTGTTCTTCTGTGTTC