Description :
From Genome Similarity Track
Location :
Scaffold_2389:321- 4066
Transcript NameFunction/comments
Phyta_totarag14443hypothetical protein

Sequence
3745 bases(100 bases per row)
AACCGAAACCGCTCATGGTGAGCGTCAAGGTCTTCGAAGGGAAGGAAGGGGAGAATCTCCTAGTATGGACCCGTGAGGTCGAAATGGCTATGAATTCAGT
CATGCTCCGAAcggagcagcaacgcgtggcgctggccaTATCTAAGCTCGGTGGAAGAGCACGAGAATGGGCACTCACGTGCGGAGCGGCTGTCGATACC
GCTTTCCCAATCTGGGATGAGCTGAAGAGTCAGCTGGTGGACTTCGTCCAAGAGTTACGTACGCTTATTGCTGGCATGTTTGCCGACCCTCTGCCTGAGG
TAGTCACTGCGACAGTGTTTATGGAAGGTCTCCGGACCGGGGTGGCCCGAACGGCAGTCTTCCGAGTCTACCCTTCTTTATTTGAAGAGGCCGTCGCGGT
GGCATTGAATGCCGagcacaacttcaagtcgGCCCGACTTGGTTGGAGTGCACCCCACTCAAACCCTTCGGGTGGTCCGGAACCCATGGATCTCAGCTac
gctgaagacgaagaagctgagcttCTAGCTGCCGAGCAGCGTATGAACATCCGGCGATGCTTCACTTGTGGCAGTACTCGCCACTTACGCATGGATGCCC
CCTGCGCAAACAGCGCCAGGCTCCACAGGATCGAAGCTCCGCTTCTTACCAGGGTTCAGATTCGTCCCGGGGAAACGGCGAATCCCAGTAGGTGCGGGGC
GGCCTACTGGGGAAGAAGTGAGTTCTGTTGCACCTCGCGGAGGTATAGGTCGACAGGGCTCCGCCCCGAAGAGATCCGGACTCTCTAATACGGACCGTGT
ATGCAAGCCGGGCTTGCTGGTCGTCCAGGCGACCGTGAAGGGCTTTGAGAAGCCGTGGACAGTTCTGATTGACTCCGGGGCGTCGGGCAATTACGCTCGA
CGCTCCACGATGGAGGGAAATCAACTGTATGTTGGAGCGCTGACAGCGCAAATGAGTGACAGCGTCACCGTTCGCCTGGCGACGGGGACTCGTGTCACGG
TGCCTAAGGTCGCGATAGACCTGAGCGTGAAGTTACTGGTCTTCGATAGCATGGAGCGCTGTCTGGTCCTAGACCTGGATTCGAGGTACGATCTCATCCT
TGGCATGGCATGGCTCGAACGCCATGAACCATGGATCGACTGGAGGTCGAAAACATTAGGTGCTACGCACTTCTCTCCTGGTGGAGCATTGGCGAGTCAT
GAACCCACCTCTGCTaggaagcagaagcgctaTTGGCGCGAGCACTGGGCCGAGTCGgccatggtgctggacatcGGTGTATTCGAGTTGATGGACAACG
CTGTTGTCGGGGATGTATGTCCCGAGTACGGCTCGACAAGCTTGATGTCGAGGGGTCCCGAGCACGTCTCGCCTGACCAACGTGGAACGGCACGTACTCC
GTTGGGTGGTGTGCGTCGGCATGACGGACCGCTGAGTGTTCACACGAGCGCTATCGACAGTACCCCGGACCCGGTCCGGACGGTGCGCGTGCGGTGGGAT
TGCTTCCCCCGAACCAAGGGCGTTTATCGCCGTGTGGCTTTGAGGACACGGGTTCACACGGGAACGGAGGTGCTTCCGCACCTGGGCTGAGCGACACTGA
TGTCGCTTTGCTGCCCTCTTCCACCCGGTCTTGGGCGTGGTGGAGGATGAGACGCAGAGCGTCTGCGATGTCGTCGGTGTCGGATGAGGTGTCCAGCGTG
TCGAGCAGCGCTCTAcgcgactgcagcgagcaAGTGTACACATTCGTGAACGGAGTGACGGGAGAAGTCGATGGCGACATCAGTCTTGAGGCTCTTCCCA
CTGTTGACGctcttctcgagctggacgtgatgtccatcgccgagttcggcgaggCCTTGAAGGCAGGCGATTTCGCTGAAGTGGTCATGATACGACCTGA
GGAGGAATTAAACTCCTCATCCCTCGTGGACGAGTCTGCCCTCGAGGAtaccaagaaggcgctcaatGCGCGCAGTGGATCCAAGACCCTTAAGGATCCG
TCAGACCCGTTTTATCCATTGCTGGTAGAGTATAGAGACGTCGTCTTGAAGAACCCGCCTATGGGTCTGCCTCCGGATCGAGGAGTTCGTCACGAGATTG
ACCTGGTTCCGGGAACCAAATACTGCGTGACGAGGCAGTGACCTCTGCCACGAGAACAGCACGACGTCATTAACGCGTTCTTCCGTGCAAAGCACGAGGC
TGGTCTGGTGCGTGAGAGTAAGTCTCCACACTCTACACCAACATTCTGTGTCAGAAAGCCGAATGGCAAGTGGCGTATCGTACATGCTTTCAACAAGCTG
AATGCAGCCACCATTCCGGCGCAGACGCCTATTCCTCGGAAGGATGTTCTCCAGAACAACATGGTCGGCTGTACGCTCTACAGTGCCCTCGACTTGGTCG
ATGGTTACTACCAGTTGCTCATGAGAGCGAGTGACATTCCACTGACAGCCGTCAACACTCCGAGCGGCATGCTCTGGGAGTGGCTGGTGATGCCTCAAGG
ACTGTCGAACGCACCGGCGACGTTCAATCGTCTAGTGACGCAGTTATTCCGGCCCATCGGGCGTATGCACAGACGTACTTTGATGACATATTTGGCCATA
GTCGTGCAGAGCACGGAAAGTCAGATGTGGAGAACCACGTCGATCATCTACGAGCAGTGCTCGAATGCATGCGCACCAGCAAATTGTATGCCAACACTGA
CAAATGCGTCTTCGGCGCGGAAGAAATTCCGTTTCTTGGGTGCTTCATTGGGAAGCGAGGCCTTCGAGCGGATCCCGCCAAGGTTAAAGCCATTGTAGAC
TGGTCGGTTCCAAAGAACAAAAAGGACTTACGTAAGTGGTTAGGCCTCGCCAATTACTTTCACAAGTACTGCGAGAATTATGCTGAGATGGCAAGGCCAT
TGTCGAATCTCCTTAAGAAGGATGCTGAGTGGTGTTGGGACACCGAGCAACATGGCGCCTTTGAGGCGATTAAGGAAAGCCTCCTTCAGGCGCCGATCCT
GGCACTCCCAGACCCGGACTGTCcgctcagcgtcgtgtgTGACGCGTTCGACTTCGCTATCGGATGTGCTTTACTTCAAGCGGACTCCGAAGGGTGCGAA
CGCGTGATCGCGTTTGAGTCTCGGCAGctcaaggctgctgagaagaACTACCCAGTTCACGACAAAGAGCTACTTGCCATGAAGTACGCTCTTGTCAGGT
TCAGGGTCCACCTGCTCGGCTCCAAGCCTTTCGTGATTTACACGGACCATGCGTCATTACGCACTGCGACCCAGTCGCCTCACGTCTCTCAGAGAATGGC
CCGATGGCTCTCCTTCTTTGCGGAGTATAACTTCAAGGTGAAGTATAAGCCGGGCAAGCATAATGTCCTGGCCGAGGCGTTATCACGCAGATCGGACTAT
GAGCTTGCTCATGTCACGACTGTGATATCGTCCGTGGCGGACTTGATTCGTGCAGCTTACGCACGTGACGACACATGCGTAGCCCTGCTACGTGGTCTTG
GGAGCAAGGAATTCCCCGATCCAGACAAGAAGATGTTGGCGCGCTCTCGCGCGAGGCTACATCGATATACCCTCGATGGTGGCCTGCTGTATTACAGCAC
AAGCTCAGCTGACACGCCTCGCGTGGTGGTCCCTCATGACGAGGACTTGAAGTATCACATCCTCTATGAGGCCCATGATACCCCACTCGGTGGCCATCTG
GGTCGTGAAAAGACCTACAGCGCTGTCAGCGCGATGTACTGGTGG