Description :
From Genome Similarity Track
Location :
Scaffold_1171:321- 2569
Sequence
2248 bases(100 bases per row)
GTATTAATAGCAAATACTAGCTTCTCCGCGATTTCGTCCCAATCTTGCTGTAGAGGGTCTTCCGCGTACACCCGTACGGACCCCATCACTGACTTCACCG
AGCGTTCCTGCTGTCCATTAGCCTGTGGCCTATAGCTCAAAGTCGCTCTTGATCTTGACTGCATCATCTCTGCGAACGCTTGGAACACCTCGCTCATGAA
GCGTGGGTCGCGGTCATGCCGTATTAATGATGGGGCTCCGAACCGTCGGTACACACATTCTTCGAACACTTGGGCAACACTCAGTGCAGTCGTATCTGAC
ATAGCCTTGGCAATAACGAAGCCCGTGAACGAGCACTGAAATAGGAGCAACGCCGTGTTGCCCCTGCGAGATTTCGGTAGTGGTAACACAAAATCCATCG
AGACGATCTGGAAAGGTCGTTCGGCTAGTACGTTGCCAGGTGAGTATCCACGAAGCTGCGGACGGCTTTTACTCGAGCTGCAATCTGGACATGACCTCAC
ATGCTTCTCCACGTCAGCGTACAAGCCGATCCAATAATAATCGGACTTAACGCGATGGAACGTTCTCACCACACCTTGATGTCCTCCTTCCAGCGAGTCG
TGACAGTTCTGCAAGACCTCTTGAATCATCGTTGTCGGTACCACAAGCCGCAGCTTGGTCTCCTCTTGCCAACCGTGGTCGTACCGACGATTCAATCCAA
GATAGTGAAGCACGCCGTCTTCAGACAATACGAACCGGTCAGCATATTTCCAAGCATCTCGAGCTTCTTTGTAACTCAGCTCCTCTGCTTGGCCCTGAAG
CACCTTCTTGATGTTAAACCACTTCTGCTCCTCGTCCTGTGCCACCATTATCCGTCTGCGTCGTTCCCGCTGTATCGCCACCGGGTCAACATCTTCCGCA
TCGGGAAATGCCGCTGGTACAGTCTTGTGAGGATGGTCTGGCAAATCTTTGCCGAATGAATCTTCGGTGGACGTCTCTCGTCGTTCTTCATGCTGTTCTT
GAGCTTTTGAGACATCCTCCGAGTGTTCATCTGCAAACCTGACGCGTTTCTTGGCTTTCGTCTGTCGCCGAGTCATCACTGCCATATTACCATAATCGCA
CTTTGGTGAGCTGTAATCAACCACGGAATTTTCGAAAGTTTTTTTCCACTTTGAAGATTCGCTGCCTGACAGTACATGTACTTGACGCTCTGCTCCACGT
GACGAAACATCTACCGAGTCTTCATCCGGCTCGTAGATCATTTCCTTGATTGTGATTCAGCGATGCCCAATTCCGACTTGCGAGTTTCAGCCAAGATTAC
CCGACTGACCTTCAATTCCAGCGCTTCAGTGGCTAACGAATCCGCGGCAGCGTTGTATTCTCGTACAACGTGAAGATATTTAACTGATCGAAGCTTGGCC
GTGAGTTCCTTGTGAGTATTCAGCAGCGCTAGCAAAGTTTCCTTCCTGCATGCGATCACCCCTAGTGATTGTTGAATCGCGAGCCTTGAGTCACCAACGA
TGACTAAATCCTCGGCACCGTGCGCAATAGCAGCCTTGACACCGTTTATCATACCTGTATACTCTGCTTCATTCACCGTGGTAGCCGAGAGGTAAGCGTT
TGCAGCAATCACTACCTTCCACTCAGGAAGGCTCCACAGCACCCATGAACAACTCCCGTAGCCACCGTACTTCTCTGTCTTCGCTGATCCGTCAAAAGAC
ATGACGAATCCGCTGTAATTACGGGAAAGCCTGGCGTACAGCAACGCGGGGTCCATTCGAATAGTCGGGGAACCCTTGTTTGGAGGCGCCACCGGCGCGA
GCGAGTCTTCCAGGTCAACGAAGCTCGTGATGCTTGACTGCAGTAGCTGCGCAAAGGCGACATCTTTCTCCTTCACGCGCTGCACCTTAAGGTGCCACTG
CGAGCTGGACCGCGCGTCCGAAGAGAGACTTCGACTTATGCACCCACTCTAACGTCGAGAATCGTGTATAGACAAGGTAGCGTCTTTCCTGCCAGCTGGA
CATAACAGATCTTCAACAGCAGAAGTAACGCCAAAACTTCCTTCTCAGCAGGATGGTAGTTCATCTCGGCCTCCTTGAGCACCCGACCGAGGAACCGTAC
GGGGTGTAACTTGCCTTCATGTTCTTGCATTAGCGTAGTGCTCAACGCCCATTCATTCGCAAAGAGCATGACGTGAACTTCTTTCGACCGATCGAAGTGC
CTGAGGATGGGTGAATGTGAAACACTCGTCTTCAATCTTTCGAAGGAA