Description :
From Genome Similarity Track
Location :
Scaffold_2045:321- 2065
Sequence
1744 bases(100 bases per row)
TATCACCCCACTCTGGAAGGGGGACACCAGGGGATCGGGCGTACATATCAGCCGATCCGCGATAACTTTCACTGGAGAGGTCTCTTCAGAAGTGTGCAGA
AGTACGTCGGCGAATGTGTCGACTGCGAGACCGGCAAAGGACGACCCACGATCAGGGGCGAGTCGCCGGGAAACATCCAGGCGACATACCCGTTCCAGAT
CATAGCAATGGATCACATACCTTCGCTACCCAAGTCGTACAAGGGTAATACGGAACTGTTGATCTGGGTCGATCTGTTCACGGGATACGTGATCGCGAAG
GCCAGTTCCTCCCGAACGGTGCAGACGATCGCCGAATCTTACGAAGAGTGCGTGTTCCGGCGATTTGGTGCTAGCGAGGTGATCAGGCACGATCGAGAGC
CGGGATTTATGGCTGACTTCTTCCGCGCCTTTAACAAGGTCCTGGGTATGCGTCAGCGAGCGACGATGGCATATCGACCTCAGGCTAACGGTACTGCAGA
GCGAATGGTACAGACGGCGACGAGGGCCCTGAAGATCTTCGTGGAGGATCTGGATCAGAGGGATTGGGATGAGTACGCAGAGCGATTGACCTTCGCGATG
AACACGGCTCAGGATCGGGTCCGTGGAGACTCCCCTTTTTATCTGGTGCATGGATGGGATCCTCGATCGACGCTCGAGGCAACGATACCTTTGGGTAGTA
CCCGGACTCGGGATCGGGATCCTCGACGGTGGCGTTATCGGATCCAGAAGCACTACGATCAGGCTCGAAGTCAGGTGAATGCTCGACTACGCGAGGCGAT
CGCGGATCGGGCCGATCGACACAATGAAGAAGTTCGACCGCACTCGATCGAAGCTGGATCTCAGGTGTGGCTGTACCTGGATCGAGTGAAAGAGGGGTAT
GCCCGGAAGTTGGCCCACCTGTGGCACGGCCCGTTCCGTGTTGCGGAGAAGATGAACGAATATACGATGAAGCTTCAGATCGCTGGTACGGACTATCACC
TGTTCCCGATCGTGCATGTTTCGAAGCTGAAGCTGGTCAGGGACTTCCCCGATCGACCGCAGATCGCGCTCACGGTGGACGCAGCGGATCGACTCGATTT
CGACGAAGTCTTACTTCCGGAGGACAGCTGGGCCCCAGATCGAGACGCGAATGAGTACGAAGTAGAGGAGATCACGGATATGCGGACGGGTCGAAGGACG
CGGTACGACCGGACTTATCGAGAATTTCTGGTGCACTGGAAGGGTGACGACGAGCCTGACTGGGTCGACGAAGCTGATCTCAACTGTGGAGCTTTATTGC
ACGAGTTCCTTCGAGATCGCGTGAACCGGAACCGATTCAGCGCGATGCAGTCTCGCGAGGAGGAGTGAGATCGGGTCAGCTTGGTGAGAGAGAGGGATGA
CGGATCGACGGGGAGGCCGTTGATCGGAGGAAGGGGTTGTATATGAACGAATGAGTGTACGTGAGTGCAGATCGGACGGTTATGGAGTGAGTACAGGAAG
ACATGAGGACAGATCTTGGCCGATCGAATTAACAACGAATGGATTGACGGGGAACAGTGGAAGATCAAGGAAGAATGTGGGTTATTACGATGGAATGGAT
CAATCTGAGTACTTCGCGCTACGTGTATGGAAGATCGGCCTCCGCGTCACTCCTATTCTTGGGGTGTGATGGTCGACTGGCTCGGTATTCGCGGAAGTCG
ATCGTGGAGACGGCAATCATGTCACGGCTGGTGTTGGGCGCCGA