Description :
From Genome Similarity Track
Location :
Scaffold_3050:321- 1917
Sequence
1596 bases(100 bases per row)
ATATGCCAAACAGTGGGAGGCAGCGTTACAGGCTGAGTTCCGAGCCCTAGTTGCTAATGGCACGTGGGAACTTGTCTCCCTACCGAAATGTCGTAAGCTA
CTAGGGTGCCATTGGGTACTTGACGTAAGATATAATCCCGACGGGATAATCGACCGGTTTAAGGCGAGGCTGGTCGTGCGTGGAAACACGCAGATCCATG
GTGTGGATGACAATGAGAGTTTTTCACCTGTGGCTAGGTACGAATCGTTACGGCTCCTACTCGCTATTGCGACTATCAAGGATCTACATGTTCATCAAAT
GGATGTGTTAACGGCGTTCCTTAACGGGACGCTCTACGAGGAAATTTACATGCAACAACCTTACGGGTTTCGACATGGTGACACTTCATGTGTCTGCAAA
CTGAAGAAACGTTTATATGACCTGAAACAGGCTCCACGAATTTGGTACGCACTCCTTAACAAGTTTTTGGAAAAACTCGGGTTTTGTCGGGGCAAAAAGG
AGTACTGTTTGTACCGTCANTTTTGGAAAAACTCGGGTTTTGTCGGTGCAAAAAGGAGTACTGTTTGTACCGTCAAAAGTGGGAGGTAAATGGAGTGATG
CACATAGTACTGATTTGTGTGTACGTGGATGATATTACTATCGCCTCAAGTATACTAACGAAGGTAAAGGCCCAACTATCAGCACGGTTCACAATGAAGG
ACTTAGGGGAGATCCATTATCTTCTGAAGATGGAAATTAAGCGTGACAGGTCTAACAAGATCCTTAGTATGTCACAACACAAGTACATTATGGACTTGAT
GCAAACGTTTGACATGGCAGAGTGTGAGACAGAGGCAACACCCCAAGCAAAAAGTGTGGAGCTACTGAAAGAGGAAAAGCTTAGTCCAGAACAAATAGCA
GCCCAGCCATTTGACTATAGGGGTTTGGTTGGCTCGCTAATGTATCTTGTTCGAGGCACACGCTCTGATATTGCCAACACAGTTAGGGAACTGAGTAAAT
TCCTATCATGCCACAGTAAGAGTCATTACAAGGCTGCCCAGAGAGTACTAAAGTATCTGAAAGGGACGTCGACGTATGGGCTCATATTTGACGGGAAATG
TGATGAGGTAGTTTATGAGCTATACACAGACGCGAGCTTCGCGAATGCTAATGAGAATCGAAAGTCAGTCACTGGGTATGTAAGCATAATGGCGGATGCG
TGCATTACATNCGCTGTCGCTGGGTATGTAAGCATAATGGCGGATGCGTGTATTACATGGAAAAGTTCGAGGCAAGATACGGTCAGTCTTCACACAGTTC
AGTCTGAACTGATTACAGCAAGTGAGGGTGTCAAAGAGAGTGAATGGTTATGGTTCCTATTGGAGGAGCTAGGGTTCAAGCAGGCAAAGCCTGTAATGTT
CTGGTGTGATAATAAAGGTACAATCAGTATTATCAGGGACCCTACTAATCACACTTCAACAAAGCATATTGAAATAAAAGGACTGTATGCTAGGGAAATT
CATGATAAGGGCAGAATAGAAGTAAAATACTGCAACACGAATGATATGGTGGCACACGCCTTAACAAAGGCTCTACCTCGTGCTCAATTTGAGAAA