Description :
From Genome Similarity Track
Location :
Scaffold_66:32098- 35608
Transcript NameFunction/comments
Phyci_94289Hypothetical protein
Phyci_94291Hypothetical protein

Sequence
3510 bases(100 bases per row)
GGCGAGACGCCCATCGCGTGCGAGCTCCTGCCGCTCTGGGACGCCGCGCCTATCACTGACGCCCCGGCCGACGTCGTGCATGACCCGCTCTCTGCGCCCG
ACCCGGCGGACGACGCGCCCTTCGCCGCCCTCCGCTCGCTGAACCGCAAGCTCTCGCTCTGGCGCGGGCCGCTGCACTGGCTGCGCGTGGACGCCGTGGT
CAACTCGACGAGCGAGTCCATGCGCGAGAGCGACGGCGAGTTCGGCAAGCTGCTGAAGGCCGCCGGCCCGGAGATCGCCGTCGAGTGCGACGCCGCGGGC
GCGTGTCGCACGGGGGACGCCGTGCTCACCCGCGGCTGCCAGCTGCCAGCCAAGTTCATCCTGCACACGGTGGGACCGCGCTACTTGCCCAAGTACCACA
ACGCGGCCGAGCATGCGCTGCACTCGTGCTACCGCAGCGTGCTCACGGCTGCCAGGGAGAACGGGCTGCGCTCCGTGGCCATCGGGTGCATCTACACGCA
GCGCAAGGGCTACCCGAGAGAGGAGGCTGCACACATCGCAGCGAGGACGGTGCGGCGGTACCTGGAGCACTACGCCGATGCCTTCGACCGAATCGTTCTG
TGCGTGGAGTCAATTCAGGACATGTTCGTGTACGAGCGGGTGCTGCCGCTGTATTTCCCGCGAACGATGCGGGAGCAGCACGAGTCACAGCTGATGCTGG
CGACGAGAGATCTCGGTTCGTTTTTTCTTTCTTGAGCATTTTTTCTTTATGTTGCTTTTGACGTCTGACGACTTGTATTTTGCCTACTGGGCAGGTGATA
GCTTTGGCGAGCCGATTATTGAAGAGCGCAAGATCCGAATCGCTGATCTCAGTCATGCGTCAGTTGATGCCTACGACAACCAGCTCGAATTCGAGCGTGG
CAAGAGCAACAGCAAGGATGAGTACCTGCAACAACAAGGTAGACACGGTTTTCCTGAAAATCCAGAAAATGACGAAGAAGGGAGTGACATCCTGGCATTC
CGGGCCATGCTCGGTGACCCAGACGTGGAGCGCTTGGACCGGCTGCAGCAGATGCAGGAGGAACGGCAGCGACGAGCAGCAGAGGCTGCAGTCGAAGAGC
AGAAGCGTCTTGAGAAGGTTACGGCGAGTACAGCTGAGTGGGATTATGTGGCGGCGCTACAACGCGCGAAGAAGGAAGATTTTTCCGACCTGAAGGCTCT
CGAGTTCTGCTACTGCGCTGGTGTAGACCTTGCCGGGCTCCCTGTGATTGTCTACCTTGCTGGAAATATGCGTGTTGATGATGTAGACCTGGAGCGCGTG
TTACTTTTCGTGCTATTGACGCTCGACTCACAGCGTGGAACTCTAACCTCTACCAGCCCGCAATTCAGCGTTCTATACGTGCACACGGACGTGACGGGCG
ACAACCAGCCTCCTAATTCCTGGCTCAAGCGACTTTTTCGTGTATTTTCTGCGGTGGCGATGCATCAGGCCCCGAGTGATCGCCCTGTTCACAACAAGGG
AGTAGACTCGGTACTTCGCTTCTTTTACGTACTGGAGCCTTCGCTAGGGCTAAAGTTTCAGCTGCTCATGTCAAGGGGGTATTGTGATGGTGGAGGCTTT
TACAACCAAGTGGTGTACCTCCAGCATCCAGATATGCTAGACAGCATTGCCCCAACTCTTCAGCTTCCGCCCCACATCTACTCGTACGTGTGAACATGTA
CTGTAGCACAACACCTAGGCTCGCTAGGTCACCGTTTGACTCATTTCTTGTTGTTGCTTGTTGGAGTAGACCTAAAGAGGACGCCGTTGGATCAAGCAGC
AGTACTAGCCCAAAAAGCGCAGCGCCTTAACGTTTTGAAAGTGTTAAGCCACGTTTGATTGTCTCGTATTTTATCAGTGCAGCTATTGCTTCCACTTCGA
CGCGTGCTGTATGATCACAACGGATTGCGCGTCGGAGCCTGCAACGAGTGTATCAGACTCGGCATGAACCGCCAAAGCGTTCCACGGCTGGAAACCCGAG
GCAAGGGGCTGTACGTGGAGGCCTCCCGGACCCTTCGCAAATCCGTTTGAAGCACCCAATGAAGCGAACGAGGTCAAGTTCTGGCCGGCTGCCGTTCCAC
TAGCACCACTATAACGCTCATATTCGACAGGATCACGAGGATTGCGACCGTGGTGGAAGTCCCAGCAGTTGACAACTGCATCATCACCACCAGTGTATAG
ATACCGAGGTGACGCCGAGTGTAGCTTCAGTGCACGTACGGCGCGCTGGTGATACGCCTCGGTGCGGGAGGGCGCATCGAGTTTGCGGCGGTCCCAGAAG
CTCACGCGACCGCCATCTGCGCCAGTGATTAACAACTCGGGCCGCGTTGGATGAGTCTCTAGTGTAGTCAAAATGCTTCTTGAGCTAGGACTGATCAAAC
CGGAAACAGCATGTCAGTACGCATAGCAGGACAGTACGGTACGACACGATCCACTAACGTACTCAGCGCAGATCGTGACAGGGTACTGGTTGTTAGCCGT
GAGGTCCCAAATCCGAAGTTGACTTCCCGGGGTCGAGCTGCCAAGGCCACCAAAGACAAAGCATAACATCCTTAGCGGGCACGAATGGCCAACAGAAAGC
GCACTGCAACGCAAGTCTATCGTACCCGACAGTGGCGACAACAGAGTCGCGGCCCAAAAACTTGATGGCATTGATCGGCAGCCGGCTCGCGCCCTCGTTT
TCTGCAGCATCGAAAGTTAGTTCCAGACATGTTATATCGTCGTCCATGCTGCGCGTACCGATCTTCTCGACGCCCGCTGCGTCGTCCAGCTTCAACCACG
CCAGAGCTCCACCAGCACTGGCCGTCACCAGGCTCGTGCGGCTCTCGCTGACCTCCACGCATGTGGCCGCAGTACCAGCAAACACGTTCTCCCACTGCGG
CATCGCGAACGGCGACAGCGGCTTACTCGCGTCTGCGTCCGACATGGCAGCGTCGTCTCCAGCGCTGGAGGACACGCGGTAGGCGAGGACTCCGCCCGCT
GACGACGCGCTGACCAGCAGATTCTCGCCCCTGGCCGCCACAAACTGCAGCGCGTTCACGTCTCCTTCGTGCTCCGCCTCCGCCAGAATGCTCAGCTCAC
ACGGACGCGCATCGCCTTCTCCACGTCTAGCAGCGAGACGGTCATAcagccagtcagtcagttagttagtcagtcagtcCGCAGCATTTACGCGTTACAA
GAAGCTAAAGGACGCACCCGAACTCTCTGCGCAGCTCTCGCTCGTCGCTCGTGGGTCGCACGGGCAGGTGGAGCGTCACGTGGTTGGTCTGTGGAGGAGC
GAAAGATGCGTGAGTTACTGCGAGCAACAAATTGGCGGCGGCTTGTGTGGCTTCGTACCTCGTTGTCCCAGCCGCCGGTGGCCACCAGAGGGAGCACCTC
GTACTCGTCCTGCAGCGTCTCCGACGCGTAGCGGACGTCGCTCACGACGCACAGCGCCTTGACCTTCTCGGCCACGAAGTGCTTCGACACGGACGCACTC
ATGCTGCGAT