Description :
From Genome Similarity Track
Location :
Scaffold_77:32097- 37296
Sequence
5199 bases(100 bases per row)
CTTCTCCATCAGCTGGCGTGAACCATTCTTCCGGTCTGAGTTGCTTCCAATAGCCCCGCGTTTCTCCAGACTGGAGATCCAAGGGCACTTCGGCGTCAGA
ACGGCTGAAGTCGTCCGATCGATGTAGACTTAAGACCTTGGCGGTAGATTTCGCATGCAGATCACATGTATTACCGCGTAGATCAGTCCGTCCACTTACT
CGATCTACCGTGTTGTTGTTCACGAATGCATAGATGCAGTACCTAGAACGCTCGGCTCGTACCGGATTCCAACCCGGCGAGCGTCCTAGTTTAACATCTT
CTCGTCGATCGCGGGCAACATGCCAGCGTGCTTCACACCATTGACGGATCTGGTTGTTGAATTCCTCCATCGGGCACTTGCCCATCTCGTGTAGTTCACC
ACATCCACGGCACACAAACAGGCAGCGATCCGTCGGATGACCTCTCTTGCCACACTTCTCGCACCTCAAACGTCTCCAACAATCGAGATCGGTGTGTTTC
CGCGATCCACAATGTGAGCAGCGGTTTGATCGCTCCGAGCCGTCAGGTGAAGATAGCGATCGTGGATCCGATCGAGGTGGGTCATGGTTGATCTGCGCTT
GGTTGCTTCGATCCGGCTTCGTCGCGTCGCCCCCAGCGTTGCGGGACTTGTCCTCGGCCGACGCTAGGTAAACGCGACGTAGATCACCCTCTGAGTCCGA
TCCGTCTGATCCCGTGTCCGATCCAGACTCCTGGCTCGCGATCTGCACTGCACGCACTGCCCGGTTGGTTGCAGCAGCTGGTGCTGAGGTCAGAACCTTC
TGAAGATACTTCGATTCAAAGGCAGATCGCTTCTGTCTGCTCTTCGCGCGCTCTCGAGCGCGCAGGACTTCCTCCAGATCTTCTGCGTCCGCAAGCCGGA
GTATAGTGAGCCGATCGGCCAGGTCCGGATCGCCCAGCGTCTCGATAAAGTGTTCGACATGTTCTCGGCGGGCCTTGGAATCTCCGTCCTTGATCTTCAA
TTTCGCACACAGAGCCGCCACATTCAGTCGATAGAGGTACTCCAACGGCGATTCATATGATCTCTTGCGAGAATGGTAATACTGCCAAGCGGCCGATACT
CCCAGGCCACAATACTGGATCTGGAAACTCCGGAGTAGATCGCTCCACTTGTTCCGCGTCGATCGGCCCAGCTGGCGGTACCAGTTCTTCGCCGGGCCCG
TCAGTTGATCAGCGAAGGTCAGGCACTTCTCTTCGTCCGTAGCCTGATCTCGCAGGGACGCCGATTTCACCTTGCTGGTCCACGATCGGGCGCGGTCTTC
GTCCTGATCCTTGCCACTGAACTCCTTAAGATCGGGCATCGCCGAAATCCGCGCACGCTGGATTAAGGAGGACCCAGTGGATCCTGAGGCAGCGGTGACC
ACCGCAGCAGGGGCCGAACTCGGTAGATCAATGTCGTCCAGATCGTATTCCCACTGAGAGGGATCTTGATCCGGCGATCCGGCTGATTCCATCTCCACGT
CCCGCGATCCAACGTTGTCGTCGACCACTGGAGTAGGTGTTGCCACCGTGGCCTGTTGTTCCTTCAGAAATCGAGCCATCGCAGCCTGAAAGTAAGAATC
CAGTCTGTTATTCGACGCATCTGATCCGGTAGCACTGGTGGTCCGATCGGTCGACTTGGGTTTCTGCTTCCGAGGTCCTGATCGCATGCGTTCCTGACGT
TGATTCCGTGATCGTGCGTCCAACATCACAGATCCTGAAGGGCCGAGGGGCATCCGTTGAGGTTCGGACGACGTATCCGATACATGTTCCGCTGCGAAGA
CATAAGGAGACGACGGTCGGTACCCAGTGGACTCCATCCGCGGCGACGACGCGGGAGCTGGCGACACTAGCACTGGCACCTTCAGGTCCGGACTGTCCGC
GATCACGTCGACCAAAGGTCTCAACTTGTCGACCAATGTCTGGATCACAGTCTGGATCACATCGAGATCTTGATCGAAAAGNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGGG