Description :
From Genome Similarity Track
Location :
Scaffold_27:32094- 35128
Transcript NameFunction/comments
Phyca_LT1534547890unnamed protein product
Phyca_LT1534507337Hypothetical protein

Sequence
3034 bases(100 bases per row)
gcacttgacattgtatctcgtgcataccagctcctgactgtcgacaattttgatgctgagccacgttctgatgaaggacgtcgccgcctgcgctttttcg
ccaactctctgttcatggatatgccggaagccaagccaattcgtaagatccgttcgctgaccgtgtcgacgccgtactacaacgaaattgtcatgtactc
gatcaaggatttgactgctcagaatgacgactgcatcaagctgttgtattacctgcagacaatctacccgtttgaatgggaaaacctccttgaacgtgtc
caagcaaaggacatgaacgaagctctaaagaagaatccggaagaggtgcagctgtgggctagttaccgaggtcagacccttgcacgtactgtccgtggta
tgatgtacaacgaggaagcaattcgctttttgcattggctggaaattggcgagaatgagcctatgcaccagctgtcgtgttcgtgcaacaagtgctgcaa
gctgaacgagatggtttcgctcaagtttaactacgtgtgcacttgccagatttacggtaagcagaaggacgagcagaagcagcaggcccaggacattgac
ttcctgatgcggaagcataccaaccttcgtgttgcttatgtggatggaccaaaaaaggttaaggacggcccgccaaagttcttctcggtgctgattcgtg
cacaagatgagaagattgtggaaatctaccgtgtggagctgccaggcaatccgattgtgggtgaaggtaagcccgaaaaccagaaccacgccattatttt
ctcgcgtggtgagctgctgcagtgtatcgatatgaaccaggacggttacctcgaagaggcgctgaagatgccgaacctgctgtccacaatggaccgaggc
actgagaaacgccctctgactattatcggtttccgtgagcacgtgttcaccggcggtgtgtcgaacctggccagttttatgtcgattcaggagctgtcgt
tcgtgtcgctcggtcagcgtatgcttgctcttttccacgtgcgccagcactacggtcaccccgatatttttgacaaactgtttgccatgagttgtggtgg
cactgctaaggcttccaagggcattaatctgtccgaagatattttcgctggtttcaacagtacactccgtggcggtcgcacatcccacgaagagttcatc
caggttggcaagggtcgtgatgttggtatgcagcaattggctctgttcgaggctaagctgtcgtctggtgctggcgaggcagtcatttctcgtgatgcca
tgcgcatggcatctcgtctggatttcttccgtcttcactcgtggttctatggtaacttgggttggtatttcacgcagtcgatgactgtcgtgggtgtgta
ctttttcatttacggcaaggtttacatggcgctgagtggcatggacagttacttccttgaaaagggtggtcttggtattgctggcacattaaacacatcg
tgggccttccagtttggtttcctacttgtggtgcctgttattgctgtcgtgggtgtggagcagggtttccgccatggtttcacctacttgctttggaaca
tcatgactcttggaccaattttcttcacgttccagatgggcactcgtatgcactacttcgaccgtacgttgattcacggtggtgccaaatatcgtgctac
gggtcgtggtttcacgatcaagcacgagaagtttgcagagcttttccgtttctacgcgtttagccacttttaccgtggagtggagttgtttttccttttg
ctcatgttttacgcgtatggcacgttctcgtggtgcaactgctcatggcgatcggatgctgacttctacaacaacgtcgagcccactgatctcgaatggc
ggacacgttgttatgctaatcactaccagacgtgcgtattgccgacaaaccagaattacggagtgatgtcttactcgctgtggattattgctgcaacgtg
gatgtgggcgccattcttctttaacccgagcggtcttgactgggataagattattgaggattacaacgactggcagaactggttgaagacgacgaatgat
tctgctgacagttggtttggctggtggtcgaatgagcaggattacctggagcacacaacgcgcggtgcccgcttcattactgctgttcgcaagcttcgtt
tcattttggttgcgatcggtatgtacttgaacatgatgtacaatgcgtacttcgagcgaccaaacagggtcatcacttcaagcgacgacatgttgacata
cgccctgtccggtttggtcatcgtgattttcttccttctcatctgctgcggttacattgcaagccgtgtgacgaagaagatgtcgatgaaacagcgtaag
cttcggaagatcaagttcctgttgacgtgctgctgcttcctcatctcgatgctgagtcttacagtgttgtcgattggcaacctgtttgcaatcttcattc
tcctgtttgtggcagtctactggttcatgcagatgtgcattttgcgtctgcagtaccaccacattgtggtgcgtgcgcttgcgcgtgcttacgaccgcgc
agttggttggatcgtgttcgggcccattatgatcgtgtcgatgttccttcctttcatctcttccttccaacagcgtgtcatgttcaacaacgccttcacc
tcgggtcttgaggtatcgaagctcttcgcacacgacgtggccccagctcaagttgttaaggtcaagcgcgtttcgaagaagaagaaaaaccgcgatgact
aagcgcaatctttaaggaggtcggctagtctagctattttgtatcttcatagaacatataacaatttgttctcctgttttgaaactcgtcttatcttctt
cagaaatatctacttatgtgcatgaaattgcagtgatattggtcagatagataaaaagcacagtatctgctgaagtaaaatgctagccctgcattcgggt
aaggtctggagttgaaacaacgtggcgtagtcct