Description :
From Genome Similarity Track
Location :
contig_4:320861- 322172
Transcript NameFunction/comments
g1119.t1hypothetical protein, variant

Sequence
1311 bases(100 bases per row)
AAACAAATGAGCTCAGATTGGCCATGAAACTCTTCGCGACGCTCGCTATGTGCCAGCAAGTACGCTTCGCTTCCCATCTACAGACAGCAAATGATGTATT
AGCATTCTACAATCAACCAGTTCAAAGTGACAGTCACGCACCTCCGTCAAGCGAGACACTGTACGATCAAACGCGAAGACCTCGTCAACGTTCGACTTCA
TGTTAACGTCGACTTGGTAGAGGCGTTCGGGCCTCTCCGGTGCCAGGCAATGCAACTATCCAGCACAAGACATAATGACGGTAAGCTTGCAACTCAAACA
CCAACACGCAGAACAACGAAAAGTAACGTACCCGGACACCGCGGTCATACATGCAGTCTACGAACGTGATGAATCGCCGCATCTGGTTGAGTCGTTCAGC
GTTGAGCAAAGAATATCGTCACAAACACAACCGAGAAGGCCTTGGAGATAGCCAAGTAGTCTGCCGCGCCGAGCGGTTTATCGCACAGGTCACGGAAGGA
AAAGCGACACGCGCCCGCTTTCACTGCAGCCTCCGGTACATGCACTTGACGCCCTTGCGTCGTCACGTAGGTCTCCACCGTCTCCTCTCCGCGACAGTAA
GTCATGAACTCGTAGTCGAACGCAGCACGGGTATCGGGCGTGATCGGATACTCGTACACATTGTCAGCATGCACCGCGCCCTTCAACACGCGGTAGTCCG
TGGTCGAGTCTTCCAGCGACACGACATTGCATCGTTCTCCTAGTAGGTCGATGAACGGCACGAACAGTTCTCGCTGCAGCCCGTTCTTGTAGAGCTCACT
TGGTGGTCTATTGGACGTGGCGACCATCACAAAGCCTCGCGCCAGCAGGGCCGAGAAGAGCCGCCTCAAGATGAGCGCGTCCGCCACGTCCGTCACCTGG
AACTCGTCGAAACAGCAGCCAGCTGTCCTGCAGCAGCTTGTCGGCGATGTGTGGGATGGGATCCTCTCGGAAGCCCTGCTGACGCAGCTCGTGCATCTGC
TTGTGGACGTCCAGCATGAACTCGTGGAAGTGGACGCGCTGCTTGTGCTCCACTGGCACATTGTCGAAGAACATGTCCATCACGAACGTCTTACCGCAGC
CCACGCCGCCGTACAGGTACAGCCCCTTGGGTGCAGCTTCCTGCGCAGGTTCCTCATCCTTTCCAGTCAATTTCTGCCACCACGAGCCACTAGACGCCGC
CTTGGCCTTGGGGCCGCCATAGCCCACGAGCGAGTCGTACAGTGCGTCCAGGTGGTGCACGGCGCGCACCTGCACGGGGTCGTACGTCACGTCGCCGTCG
TCCGCGCGCTG