Description :
From Genome Similarity Track
Location :
Scaffold_13:320787- 322746
Transcript NameFunction/comments
Phyci_214774papain-like cysteine protease C1

Sequence
1959 bases(100 bases per row)
GAGGATTTGAGGTCCGTTGTCGTAGATTTTTTCTTAGTAGCGGGAGCAGGAGCTGATGCAGGAGCCACAGTCTTCGGGGCCTTAGTGGCAGGTGGGTCTG
TCGCTGGAGGCTCGGTGGCCGGGGCCTCAGTGACAGGGGGGTCTGTCGCTGGCGGGTCTGTCGGAGGATCCGTTGGAGCTGATGTCGGCGCTGGAGTTGT
TGGCGGCTGTGTTGCCGGTGTTTCGTCGGTGCTAGGAGGTTCCGTCCACTGATTATTGTTGTTGTTGGACGATCCTGAAGACCACTGGTTTCCTGAAGAA
TCCGCCGATGGGCCCCATTGCGAGTTCGATGGCCCGGATGGTGGTGTCCATTGCGAGTTACCTGAACCGGAAGGCGGGGTCCACCCCGATGGTGGTGCCG
TCCATTGGGTACCGGGCGACGGGGTCCACTGCGAGTCTCCTGCATTTGAGCCTCCCCACTGGTTCCACCAATTATTGTTGCCCCACCAAGTGCCGTTGTA
TCCCCAGCCATTGTTCCCCCACCAGTTCCAGGCCTGGTTGTTGGGCCCAGTGGGGCTGCCTGTCGAAACAGTACCGACTTGAGAACTGTCGCCTGTGGAG
ACATCTCCGAAGTTCCATGCCCCGTTCGCGTTCGTGTTAGTGTTCGCGTTCGTGTTTCCTCCGTTGCTACCGCTGTTGACAGTACCCTGGTACGTCGGCT
GGGAAGTCTGGGTGTAGGAGTCGGAAGTGCTTTGGTAGCCTTTCTCGGCATCTGCGCTGTAATCTGTGCCTCCATTGAAAGCGTACTGACTTTTACCTGA
AGTGCGAAGGCGACGCATACTCCCGTCATGCTTAGACGCTTTGTTCTTGGATTCCGCGCTGGATGGTGTGTTGTTCTGGTCATTCTGTTTGTTCTGGTTG
TCTGACAACGATTTGGGCTTTTCAATTGACGGGGCGTTGACCTTGCCTGCCTCATCGACGTGAGAATTCGACAAAAACTGCTTGAACTCTTCCATCGTCA
TGAGAGTGAAGGGTCCGTCCGTGCTGAATATCGCCATCGGGTTGGCCTCCCGCGCCTCTGAAATCTGTTCCTGAGTCAGGTAGAACCGCTGCCGCTGGTC
TTCTAGCTCATCGTCCAAGCTGCGCGATTCCGTGACTGGGATATATCCGTTTTTGTGTCCGTTCGGGCCCCACTTCTTCAGCCATGCCTTCAGCCCGACA
GAAACATTGTCCTTTTCCTCCAAGTACCGATGGTATTTCGACACGATGGCCGCGTGCATCGGTCGCGCGTCGACGACTGTGGTGGTGTCGGGCAGACCGG
CCGCCATGACGGCGATCGCCAACGCGACCGCAGCGGTCGACACTCGAGGCTGCATGGTGCGTCCTACCTTTTGCCTGTCTCGATGTCCTCCGTGAGTCCC
AAACTAGCCAGATGTGGGGTCTGAGTGCCCGCAACGCAGCAAGTTTGAAAATGCCCAAGCTGCGTAGAAGCGACGTGGGAGCTTGCTTTGCGATTGTAAG
TTAGCCCAGGATCGGGCCACCGGATAGAGTCGGGAATTCAATTTGCACCTGTTGCCTGTCTTCTGAGTGCATTGCGGCATTATTCCATCATTTCGCACTG
GCAATGCCAGTCTGGCATGCCGGCAACGCAGTAGGTCGTCAACGTTGCATCTTCCTACTTGCAACTCGATGTCGACATTTCAGTGTGGGCGATTAAAGAG
CATCAGGTGGCTGGTGTTCGAACAGCCAACGGGCACAGCAGACCAGGACTCAACATGATTCCTCCCATCGTGATCCAGCAGCAACCAGCTGTAAAGTTAG
AAACGTTGCTACAAAATAGTTTAGCATCTGCGAGTTTGACGAGCAGGTGGTGCAGTGACGCTATGTGCATAGCAAAGAAGACATAGCGCTGCGGGATCGA
TAACCAGAGATCCTGTGAGGACTGATAACATGTCTAGTCGTTACGGTCGCGATGCTTGT