Description :
From Genome Similarity Track
Location :
contig_67:3207- 4409
Transcript NameFunction/comments
g11577.t1hypothetical protein

Sequence
1202 bases(100 bases per row)
TTACTCCTACGCTTCCTCCTACACGTGCGCACACGTGTAAGCTTAAGTAGTGGGTCTAAGCAGACCCATTACACCTGGTAGCACTTTGTAGTCCGTCCAA
CGACCGACTAACACGTTCGTATGGAATACGAACGCGGGGCTGAGAACCTGCCCTCGGACAGTAACATGTCCGTGGGTAGCCCAAACACGTCTGCAACGCA
TGTTGCGCGTGCAGACTGCCCCACCTGTCGGAACCAGAGTGGGAGGCCCTCCAACGACTGTCAACAGTCATTGGGGAAGCGGCGGTAGCAACGATGTTGC
GAACGCTATCACCGACGGAGCAACACGGTGTTGCTCTGGGTTTCATCGTGAAGGAACAGCGTGAAACCGCTGCTCGAACTTCGGTGTCGCCATCGGCCAC
ACCGCGCGTGGAGTCATTGAAACTCCACGTAAGCAGCTACGTTGGAAGAGAGGGCGAGCCTCTCCTCCGTTGGCTTGTCGAGGTCGACACTGCCATTACG
GCTCGACGTATCGTCGACCCGTTGTCGAAGGTTGCGTTCGCCATGTCATGTCTTGGCGGACGAGCGAGGAGTTGGGCGTACGGACGCCGACTCACAGATC
CTACGTGCTTTAGCACGTACGAGGATTTCAAGGAGGAGCTCAAACAAGCGTTTGAGCCCCCGCAGAACGAGTTCCGATCGAGGGCGGAGTTCCTCGATCT
GCAACAGGGCAAGCATGACGTGCATGCTTACGCCCAAAGAGCACGGTACTTGGTCTCGAATATCGTGACCAACCCGATTGACGAGGCGACAAAGGTCGTC
ACGTTCATGAAGGGCCTTAGAGATGGGCCTGTGAAGACCTATCTCTTCCGAGAGTATCCAAATACTCTCGAGGCTGCAATTGCGCTTGCAATGCAAGAAG
AGTTTAGCCTGCGGCAGGCTAAACTGCATGTGAACGCCCCACGGCTGATGCCACGACCGGTGGCAAGGCCGTCGGGAGGTCCCGAACCAATGGACCTCTC
GAGTGCGACCGCTGCTGGTTCCCAGCAGCGTCGTGGATCAACGAATGTGCGTTGTTTCCGCTGCGGAAACATCGGTCACTATGCCCGCGAGTGCACAGCA
CCTGTGCACGCGGCGAGGAGCCGTCGTGGCGATACTGGGTATCGCCACGGGCAATCAAAAAACTAGAGGGACCAGCAGGCGCGGGGCGCCCTGCTGGTGA
TG